Arhgap15 (NM_001025377) Mouse Untagged Clone

CAT#: MC211708

Arhgap15 (untagged) - Mouse Rho GTPase activating protein 15 (Arhgap15), transcript variant 2, (10ug)



  "NM_001025377" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5830480G12Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211708 representing NM_001025377
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAAAAGGACAAGCTGCAGTGTGCAGACATCTACAAACTGTGACAACTCTCTGGAAATACTGAATT
CTGCCCACCAAGCTACAGGAGCTGTGCAAATGAGAATCAAAAATGCCAACAGCCACCAAGACAGGCAGAG
CCAAACTAAATCCATGATCCTCACCGATGCTGGGAAGGTCACTGAACCTATTTCCCGGCACAGAAGGAAT
CATTCACAGCATGTGTTGAAAGATGTCATTCCACCACTAGAACATCCAATGGTTGAAAAAGAAGGGTATC
TTCAAAAAGCCAAAATTGCAGATGGAGGAAAGAAACTAAGGAAAAACTGGTCTACTTCCTGGATTGTTCT
TTCTGGTCGAAAAATTGAATTTTACAAAGACTCCAAGCAGCAAGCTCTTCCTAACATGAAAACCAGGCAC
AACGTGGAAAGTGTGGATTTGTGTGGTGCACATATAGAATGGGCCAAAGAAAAATCAAGCAGAAAGAGTG
TCTTTCAGGTAAGAATGCCACCTGTGCTCAATTTCCTCCTTTTCCCTCCAAATCTGAGCCCCCTCAGGTA
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025377
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025377.1, NP_001020548.1
RefSeq Size 1816 bp
RefSeq ORF 561 bp
Locus ID 76117
Gene Summary The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...