Elovl7 (NM_029001) Mouse Untagged Clone

CAT#: MC211536

Elovl7 (untagged) - Mouse ELOVL family member 7, elongation of long chain fatty acids (yeast) (Elovl7), (10ug)



  "NM_029001" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9130013K24Rik; AI840082
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211536 representing NM_029001
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTTCAGTGATCTTACATCGAGGACTGTGCGTTTTTATGATAATTGGATCAAAGATGCTGATCCGA
GAGTTGAAGACTATCTCCTCATGTCCTCGCCTCTGCCACAAACCATCATCCTGGGCCTCTATGTCTATTT
TGTTACGTCTCTGGGACCAAAGCTCATGGAGAACCGGAAGCCCTTTGAACTCAAGAAAGCGATGATAACG
TACAATTTTTTCATAGTACTGTTTTCTGTGTATATGTGTTATGAGTTTGTGATGTCTGGCTGGGGTACAG
GTTACTCGTTTCGATGTGACATTGTTGACTATTCTCAGTCGCCAAGAGCAATGAGGATGGTGCACACCTG
CTGGCTTTATTACTTCTCCAAATTCATCGAGCTGTTAGACACTATCTTTTTTGTTCTGCGTAAGAAAAAC
AGCCAAGTGACTTTCCTTCATGTCTTCCATCATACGATCATGCCGTGGACCTGGTGGTTTGGAGTCAAAT
TTGCTGCAGGTGGTCTGGGAACATTCCATGCCTTTTTAAATACAGCTGTGCACGTGGTCATGTATTCTTA
CTATGGGTTATGTGCAATGGGACCAGCCTACCAGAAGTATTTATGGTGGAAAAAACATTTGACATCTTTG
CAGCTTGTCCAGTTTGTTCTTGTCACTATCCACATAGGCCAGATCTTCTTCATGGAGGACTGCAATTACC
AGTACCCAGTTTTTCTGTATATCATCATGAGTTACGGATGCATCTTCCTGCTGCTCTTTCTCCACTTTTG
GTACCGTGCTTACACCAAGGGTCAGAGGTTGCCCAAAACTCTAGAAAATGGAAATTGCAAAAGCAAGCGC
CACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_029001
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_029001.5, NP_083277.3
RefSeq Size 5453 bp
RefSeq ORF 846 bp
Locus ID 74559
UniProt ID Q9D2Y9
Gene Summary Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme with higher activity toward C18 acyl-CoAs, especially C18:3(n-3) acyl-CoAs and C18:3(n-6)-CoAs. Also active toward C20:4-, C18:0-, C18:1-, C18:2- and C16:0-CoAs, and weakly toward C20:0-CoA. Little or no activity toward C22:0-, C24:0-, or C26:0-CoAs. May participate in the production of saturated and polyunsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...