Pradc1 (NM_028505) Mouse Untagged Clone
CAT#: MC211408
Pradc1 (untagged) - Mouse RIKEN cDNA 1700040I03 gene (1700040I03Rik), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700040I03Rik; Pap21 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211408 representing NM_028505
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCCGTGGCGCCGCGGGCTGGTGCTGTCTCGTGCTCTGGCTGCCCACGTGCGTCGCGGCCCACGGCT TACGCATCCATGACTACTTATACTTCCAAGTGCTGAGTCCTGGGGATATTCGATACATCTTCACAGCCAC ACCTGCCAAGGACTTTGGTGGGATATTTCACACACGGTATGAGCAGATTCACCTCGTCCCTGCTGAACCT CCAGAGGCCTGCGGGGAACTCAGCAACGGCTTCTTTATCCAGGACCAGATCGCTCTGGTGGAAAGGGGCT ACATGATCCGCCGTTCTCTGGAACAGCACGGGCTACCATGGGCCATCATCTCTATCCCAGTCAATGTCAC CAGTATCCCCACCTTTGAGCTACTGCAACCTCCGTGGACTTTCTGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_028505 |
Insert Size | 399 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_028505.2, NP_082781.1 |
RefSeq Size | 914 bp |
RefSeq ORF | 399 bp |
Locus ID | 73327 |
UniProt ID | Q9D9N8 |
Gene Summary | Plays a role in the modulation of physical activity and adiposity.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the shortest transcript and encodes the shorter isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218251 | Pradc1 (tGFP-tagged) - Mouse RIKEN cDNA 1700040I03 gene (1700040I03Rik) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR218251 | Pradc1 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1700040I03 gene (1700040I03Rik), transcript variant 1 |
CNY 1,200.00 |
|
MR218251L3 | Lenti ORF clone of Pradc1 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1700040I03 gene (1700040I03Rik), transcript variant 1 |
CNY 4,750.00 |
|
MR218251L4 | Lenti ORF clone of Pradc1 (mGFP-tagged) - Mouse RIKEN cDNA 1700040I03 gene (1700040I03Rik), transcript variant 1 |
CNY 4,750.00 |