Acbd6 (NM_026683) Mouse Untagged Clone
CAT#: MC211333
Acbd6 (untagged) - Mouse acyl-Coenzyme A binding domain containing 6 (Acbd6), transcript variant 3, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610010G04Rik; 2610100E10Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211333 representing NM_026683
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCACACCGTTCCTACCCTCGGGGGCCACCACAGGCGACAGCGGTGGGGAACTGAGCTCCGGGGACG ACTCTGGTGATATGGAATCCTTCCAGACCCCCGAGGCCGAGGGGACCCGGAGTTTGGCCGAGCTGTTTGA GAAGGCTGCCGCACACGTCCAAGGCCTGGTTCAGGTAGCCAGCCGGGAGCAGCTCCTGTACCTGTATGCC AGGTTCAAGCAGGTCAAAGTTGGAAATTGCAATACTCCTAAACCAAATTTCTTTGATTTTGAAGGAAAGC AAAAATGGGAGGCATGGAAAGCCCTCGGTGACTCAAGCCCTAGCCAAGCAATGCAGGAATATATCGCGGC AGTTAAAAAACTAGATCCAGGATGGAATCCTCAGGTTCCTGCCCTCCTTGAGTTCCTGTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_026683 |
Insert Size | 414 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_026683.1, NP_080959.1 |
RefSeq Size | 992 bp |
RefSeq ORF | 414 bp |
Locus ID | 72482 |
UniProt ID | Q9D061 |
Gene Summary | Binds long-chain acyl-coenzyme A molecules with a strong preference for unsaturated C18:1-CoA, lower affinity for unsaturated C20:4-CoA, and very weak affinity for saturated C16:0-CoA. Does not bind fatty acids (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216565 | Acbd6 (tGFP-tagged) - Mouse acyl-Coenzyme A binding domain containing 6 (Acbd6) transcript variant 3, (10ug) |
CNY 2,090.00 |
|
MR216565 | Acbd6 (Myc-DDK-tagged) - Mouse acyl-Coenzyme A binding domain containing 6 (Acbd6), transcript variant 3 |
CNY 1,900.00 |
|
MR216565L3 | Lenti ORF clone of Acbd6 (Myc-DDK-tagged) - Mouse acyl-Coenzyme A binding domain containing 6 (Acbd6), transcript variant 3 |
CNY 3,800.00 |
|
MR216565L4 | Lenti ORF clone of Acbd6 (mGFP-tagged) - Mouse acyl-Coenzyme A binding domain containing 6 (Acbd6), transcript variant 3 |
CNY 3,800.00 |