Rab38 (NM_028238) Mouse Untagged Clone
CAT#: MC211331
Rab38 (untagged) - Mouse RAB38, member of RAS oncogene family (Rab38), (10ug)
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310011F14Rik; AU043391; cht |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211331 representing NM_028238
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGACACCTCACAAGGAGCACCTGTACAAGCTGCTGGTGATCGGCGACCTGGGTGTGGGCAAGACCA GCATTATCAAGCGCTATGTGCACCAAAACTTCTCCTCGCACTACCGGGCCACCATTGGTGTGGACTTCGC GCTGAAGGTGCTCCACTGGGACCCAGAGACGGTGGTGCGCTTGCAGCTCTGGGACATTGCTGGTCAAGAA AGATTTGGAAACATGACAAGAGTTTATTACCGGGAAGCTATGGGGGCATTTATTGTTTTTGATGTCACCA GACCAGCCACATTTGAAGCCGTGGCAAAGTGGAAAAATGATTTGGACTCAAAGTTAACGCTCCCTAATGG TAAGCCAGTGTCAGTGGTTCTGTTGGCCAACAAATGTGACCAAGGGAAGGATGTGCTTATGAACAATGGA CTCAAGATGGACCAGTTCTGCAAGGAGCATGGCTTCGTAGGATGGTTTGAAACATCAGCCAAGGAAAACA TAAACATTGATGAAGCCTCAAGATGCCTGGTCAAGCACATACTTGCAAATGAGTGTGACCTCCTAGAGTC TATAGAACCGGACATTGTGAAGCCCCATCTCACATCGCCCAAGGTTGTCAGCTGCTCTGGCTGTGCCAAA TCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_028238 |
Insert Size | 636 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC089578, AAH89578 |
RefSeq Size | 1577 bp |
RefSeq ORF | 636 bp |
Locus ID | 72433 |
UniProt ID | Q8QZZ8 |
Gene Summary | Plays a role in the maturation of phagosomes that engulf pathogens, such as S.aureus and Mycobacterium (By similarity). May be involved in melanosomal transport and docking. Involved in the proper sorting of TYRP1. Involved in peripheral melanosomal distribution of TYRP1 in melanocytes; the function, which probably is implicating vesicle-trafficking, includes cooperation with ANKRD27 and VAMP7 (PubMed:21187289). Plays an important role in the control of melanin production and melanosome biogenesis (By similarity). In concert with RAB32, regulates the proper trafficking of melanogenic enzymes TYR, TYRP1 and DCT/TYRP2 to melanosomes in melanocytes (PubMed:26620560).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224055 | Rab38 (tGFP-tagged) - Mouse RAB38 member of RAS oncogene family (Rab38), (10ug) |
CNY 5,200.00 |
|
MR224055 | Rab38 (Myc-DDK-tagged) - Mouse RAB38, member of RAS oncogene family (Rab38) |
CNY 3,600.00 |
|
MR224055L3 | Lenti ORF clone of Rab38 (Myc-DDK-tagged) - Mouse RAB38, member of RAS oncogene family (Rab38) |
CNY 5,890.00 |
|
MR224055L4 | Lenti ORF clone of Rab38 (mGFP-tagged) - Mouse RAB38, member of RAS oncogene family (Rab38) |
CNY 5,890.00 |