United States
Germany
Japan
United Kingdom
China
Rarres2 (NM_027852) Mouse Untagged Clone
CAT＃: MC211210
Rarres2 (untagged) - Mouse retinoic acid receptor responder (tazarotene induced) 2 (Rarres2), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610007L05Rik; AI303516 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC211210 representing NM_027852
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGTGCTTGCTGATCTCCCTAGCCCTATGGCTGGGCACAGTGGGCACACGTGGGACAGAGCCCGAAC TCAGCGAGACCCAGCGCAGGAGCCTACAGGTGGCTCTGGAGGAGTTCCACAAACACCCACCTGTGCAGTT GGCCTTCCAAGAGATCGGTGTGGACAGAGCTGAAGAAGTGCTCTTCTCAGCTGGCACCTTTGTGAGGTTG GAATTTAAGCTCCAGCAGACCAACTGCCCCAAGAAGGACTGGAAAAAGCCGGAGTGCACAATCAAACCAA ACGGGAGAAGGCGGAAATGCCTGGCCTGCATTAAAATGGACCCCAAGGGTAAAATTCTAGGCCGGATAGT CCACTGCCCAATTCTGAAGCAAGGGCCTCAGGATCCTCAGGAGTTGCAATGCATTAAGATAGCACAGGCT GGCGAAGACCCCCACGGCTACTTCCTACCTGGACAGTTTGCCTTCTCCAGGGCCCTGAGAACCAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_027852 |
| Insert Size | 489 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_027852.2, NP_082128.1 |
| RefSeq Size | 708 bp |
| RefSeq ORF | 489 bp |
| Locus ID | 71660 |
| UniProt ID | Q9DD06 |
| Gene Summary | Adipocyte-secreted protein (adipokine) that regulates adipogenesis, metabolism and inflammation through activation of the chemokine-like receptor 1 (CMKLR1). Its other ligands include G protein-coupled receptor 1 (GPR1) and chemokine receptor-like 2 (CCRL2). Positively regulates adipocyte differentiation, modulates the expression of adipocyte genes involved in lipid and glucose metabolism and might play a role in angiogenesis, a process essential for the expansion of white adipose tissue. Also acts as a proinflammatory adipokine, causing an increase in secretion of proinflammatory and prodiabetic adipokines, which further impair adipose tissue metabolic function and have negative systemic effects including impaired insulin sensitivity, altered glucose and lipid metabolism, and a decrease in vascular function in other tissues. Can have both pro- and anti-inflammatory properties depending on the modality of enzymatic cleavage by different classes of proteases. Acts as a chemotactic factor for leukocyte populations expressing CMKLR1, particularly immature plasmacytoid dendritic cells, but also immature myeloid DCs, macrophages and natural killer cells. Exerts an anti-inflammatory role by preventing TNF/TNFA-induced VCAM1 expression and monocytes adhesion in vascular endothelial cells. The effect is mediated via inhibiting activation of NF-kappa-B and CRK/p38 through stimulation of AKT1/NOS3 signaling and nitric oxide production. Exhibits an antimicrobial function in the skin.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Variants 2 and 3 encodes the protein (isoform 2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222586 | Rarres2 (tGFP-tagged) - Mouse retinoic acid receptor responder (tazarotene induced) 2 (Rarres2), (10ug) |
CNY 2,800.00 |
|
| MR222586 | Rarres2 (Myc-DDK-tagged) - Mouse retinoic acid receptor responder (tazarotene induced) 2 (Rarres2) |
CNY 1,200.00 |
|
| MR222586L3 | Lenti ORF clone of Rarres2 (Myc-DDK-tagged) - Mouse retinoic acid receptor responder (tazarotene induced) 2 (Rarres2) |
CNY 4,750.00 |
|
| MR222586L4 | Lenti ORF clone of Rarres2 (mGFP-tagged) - Mouse retinoic acid receptor responder (tazarotene induced) 2 (Rarres2) |
CNY 4,750.00 |
其它Rarres2产品
