Ube2v2 (NM_001159351) Mouse Untagged Clone
CAT#: MC211088
Ube2v2 (untagged) - Mouse ubiquitin-conjugating enzyme E2 variant 2 (Ube2v2), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110021H13Rik; 4632410D19Rik; 5730524P06Rik; 6820402M05; AI848315; C81524; MMS2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211088 representing NM_001159351
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTAATTTTCGCTTGTTGGAAGAACTTGAAGAAGGACAAA AAGGAGTAGGTGATGGTACTGTTAGCTGGGGCCTTGAAGATGATGAAGACATGACACTTACAAGGTGGAC AGGCATGATTATTGGGCCACCAAGGGTGGATGCACGGAGCATACCAGTATTAGCAAAATGGCAAAATTCC TATAGCATTAAAGTCATACTTCAAGAGCTAAGACGTCTTATGATGTCCAAAGAAAATATGAAGCTTCCAC AGCCTCCAGAAGGACAGACGTACAACAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159351 |
Insert Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001159351.1, NP_001152823.1 |
RefSeq Size | 5766 bp |
RefSeq ORF | 312 bp |
Locus ID | 70620 |
UniProt ID | Q9D2M8 |
Gene Summary | Has no ubiquitin ligase activity on its own. The UBE2V2/UBE2N heterodimer catalyzes the synthesis of non-canonical poly-ubiquitin chains that are linked through 'Lys-63'. This type of poly-ubiquitination does not lead to protein degradation by the proteasome. Mediates transcriptional activation of target genes. Plays a role in the control of progress through the cell cycle and differentiation. Plays a role in the error-free DNA repair pathway and contributes to the survival of cells after DNA damage.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218653 | Ube2v2 (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2 variant 2 (Ube2v2) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
MR218653 | Ube2v2 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2 variant 2 (Ube2v2), transcript variant 2 |
CNY 1,900.00 |
|
MR218653L3 | Lenti ORF clone of Ube2v2 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2 variant 2 (Ube2v2), transcript variant 2 |
CNY 3,800.00 |
|
MR218653L4 | Lenti ORF clone of Ube2v2 (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2 variant 2 (Ube2v2), transcript variant 2 |
CNY 3,800.00 |