Kcnip1 (NM_001190886) Mouse Untagged Clone
CAT#: MC211058
Kcnip1 (untagged) - Mouse Kv channel-interacting protein 1 (Kcnip1), transcript variant C, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | KCHIP1; Kchip1.2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211058 representing NM_001190886
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCAGCTGCTCCAAAAGATGCAGACTCGGGTTCGTGAAATTTGCCCAGACCATCTTTAAACTCATCA CCGGGACCCTCAGCAAAGACAAGATTGAGGATGAGCTAGAGATGACCATGGTTTGCCACCGGCCTGAGGG ACTGGAGCAGCTTGAGGCACAGACGAACTTCACCAAGAGAGAACTGCAAGTCTTGTACCGGGGATTCAAA AACGAGTGCCCTAGCGGTGTGGTCAATGAAGAAACATTCAAGCAGATCTACGCTCAGTTTTTCCCTCACG GAGATGCCAGCACATATGCACATTACCTCTTCAATGCCTTCGACACCACCCAGACAGGCTCTGTAAAGTT CGAGGACTTTGTGACTGCTCTGTCGATTTTACTGAGAGGGACAGTCCATGAAAAACTAAGGTGGACGTTT AATTTGTATGACATCAATAAAGACGGCTACATAAACAAAGAGGAGATGATGGACATAGTCAAAGCCATCT ATGACATGATGGGGAAATACACCTATCCTGTGCTCAAAGAGGACACTCCCAGGCAGCATGTGGATGTCTT CTTCCAGAAAATGGATAAAAATAAAGATGGCATTGTAACGTTAGATGAATTTCTTGAATCATGTCAGGAG GATGACAACATCATGAGATCTCTACAGCTGTTCCAAAATGTCATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001190886 |
Insert Size | 678 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001190886.1, NP_001177815.1 |
RefSeq Size | 2247 bp |
RefSeq ORF | 678 bp |
Locus ID | 70357 |
UniProt ID | Q9JJ57 |
Gene Summary | Regulatory subunit of Kv4/D (Shal)-type voltage-gated rapidly inactivating A-type potassium channels. Regulates channel density, inactivation kinetics and rate of recovery from inactivation in a calcium-dependent and isoform-specific manner. Modulates KCND2/Kv4.2 currents (PubMed:14572458). In vitro, modulates KCND1/Kv4.1 currents (By similarity). Increases the presence of KCND2 at the cell surface.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (C) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant A. The resulting protein (isoform C) has a distinct N-terminus and is shorter than isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222367 | Kcnip1 (tGFP-tagged) - Mouse Kv channel-interacting protein 1 (Kcnip1) transcript variant C, (10ug) |
CNY 2,470.00 |
|
MR222367 | Kcnip1 (Myc-DDK-tagged) - Mouse Kv channel-interacting protein 1 (Kcnip1), transcript variant C |
CNY 2,280.00 |
|
MR222367L3 | Lenti ORF clone of Kcnip1 (Myc-DDK-tagged) - Mouse Kv channel-interacting protein 1 (Kcnip1), transcript variant C |
CNY 4,180.00 |
|
MR222367L4 | Lenti ORF clone of Kcnip1 (mGFP-tagged) - Mouse Kv channel-interacting protein 1 (Kcnip1), transcript variant C |
CNY 4,180.00 |