United States
Germany
Japan
United Kingdom
China
Mcts1 (NM_026902) Mouse Untagged Clone
CAT＃: MC210839
Mcts1 (untagged) - Mouse malignant T cell amplified sequence 1 (Mcts1), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1500019M23Rik; MCT-1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC010486
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCAAGAAATTTGATGAAAAAGAAAATGTGTCCAACTGCATCCAGTTGAAAACCTCGGTTATTAAGG GTATTAAAAATCAATTGCTAGAGCAATTTCCAGGTATTGAACCATGGCTTAATCAAATCATGCCTAAGAA AGACCCTGTGAAAATTGTCCGATGCCATGAACACATAGAAATCCTTACAGTAAATGGAGAATTACTGTTT TTTAGACAAAGAGAAGGGCCTTTTTATCCAACTTTAAGATTACTTCATAAATATCCTTTTATCTTGCCAC ATCAGCAGGTTGATAAAGGAGCCATCAAATTTGTACTCAGTGGAGCAAATATCATGTGTCCTGGCTTAAC TTCTCCCGGAGCTAAGCTTTATCCTGCTGCAGTAGATACTATTGTTGCAATCATGGCAGAAGGAAAACAA CATGCTTTATGTGTGGGTGTCATGAAGATGTCTGCAGAAGATATTGAGAAAGTAAACAAAGGAATTGGCA TTGAAAATATCCATTATCTAAATGATGGTCTGTGGCATATGAAGACATATAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_026902 |
| Insert Size | 546 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC010486, AAH10486 |
| RefSeq Size | 802 bp |
| RefSeq ORF | 546 bp |
| Locus ID | 68995 |
| UniProt ID | Q9DB27 |
| Gene Summary | Anti-oncogene that plays a role in cell cycle regulation; decreases cell doubling time and anchorage-dependent growth; shortens the duration of G1 transit time and G1/S transition. When constitutively expressed, increases CDK4 and CDK6 kinases activity and CCND1/cyclin D1 protein level, as well as G1 cyclin/CDK complex formation. Involved in translation initiation; promotes recruitment of aminoacetyled initiator tRNA to P site of 40S ribosomes. Can promote release of deacylated tRNA and mRNA from recycled 40S subunits following ABCE1-mediated dissociation of post-termination ribosomal complexes into subunits. Plays a role as translation enhancer; recruits the density-regulated protein/DENR and binds to the cap complex of the 5'-terminus of mRNAs, subsequently altering the mRNA translation profile; up-regulates protein levels of BCL2L2, TFDP1, MRE11, CCND1 and E2F1, while mRNA levels remains constant. Hyperactivates DNA damage signaling pathway; increased gamma-irradiation-induced phosphorylation of histone H2AX, and induces damage foci formation. Increases the overall number of chromosomal abnormalities such as larger chromosomes formation and multiples chromosomal fusions when overexpressed in gamma-irradiated cells. May play a role in promoting lymphoid tumor development: lymphoid cell lines overexpressing MCTS1 exhibit increased growth rates and display increased protection against apoptosis. May contribute to the pathogenesis and progression of breast cancer via promotion of angiogenesis through the decline of inhibitory THBS1/thrombospondin-1, and inhibition of apoptosis. Involved in the process of proteasome degradation to down-regulate Tumor suppressor p53/TP53 in breast cancer cell; Positively regulates phosphorylation of MAPK1 and MAPK3 (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG223879 | Mcts1 (tGFP-tagged) - Mouse malignant T cell amplified sequence 1 (Mcts1), (10ug) |
CNY 2,850.00 |
|
| MR223879 | Mcts1 (Myc-DDK-tagged) - Mouse malignant T cell amplified sequence 1 (Mcts1) |
CNY 2,400.00 |
|
| MR223879L3 | Lenti ORF clone of Mcts1 (Myc-DDK-tagged) - Mouse malignant T cell amplified sequence 1 (Mcts1) |
CNY 4,750.00 |
|
| MR223879L4 | Lenti ORF clone of Mcts1 (mGFP-tagged) - Mouse malignant T cell amplified sequence 1 (Mcts1) |
CNY 4,750.00 |
