Myct1 (NM_026793) Mouse Untagged Clone

CAT#: MC210767

Myct1 (untagged) - Mouse myc target 1 (Myct1), (10ug)



  "NM_026793" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110020B04Rik; AI225941; AI642973; Mtmc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210767 representing NM_026793
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTAATAACACCACGAGCTTAGGGAGTCCTTGGCCAGAAAACTTTTGGGAGGACCTTATAATGTCCT
TCACCGTATCCGTGGCGATTGGGCTTGCAATCGGAGGATTTCTCTGGGCGCTGTTCGTTTTTCTGTCTCG
AAGAAGAAGAGCCAGTGCACCCATTTCGCAGTGGAGTCCCACCAGGAGACCCAGGTCTTCCTACAACCAC
GGCCTCAACAGGACTGGGTTCTACCGCCACAGTGGCTATGAACGGCGAAGCAACCTCAGCCTGGCCAGCC
TCACTTTCCAGAGACAAGCTTCCATGGAGCTGGTCAACTCCTTCCCAAGGAAATCAAGCTTTAGGGCTTC
GACTTTCCATCCCTTCCTGCAATGCCCACCACTTCCGGTGGAAACGGAGAGTCAGCTGATGACCCTGTCT
GCCTCCACCACCCCTTCCACCCTCAGCACCGCACACAGCCCGAGCCGGCCAGACTTCCGCTGGTCCAGCA
ACAGCTTGCGGATGGGCCTTTCCACACCGCCCCCACCTGCCTATGAATCCATCATAAAGGCATTTCCCGA
TTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026793
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_026793.2, NP_081069.1
RefSeq Size 2792 bp
RefSeq ORF 567 bp
Locus ID 68632
UniProt ID Q8R411
Gene Summary May regulate certain MYC target genes, MYC seems to be a direct upstream transcriptional activator. Does not seem to significantly affect growth cell capacity. Overexpression seems to mediate many of the known phenotypic features associated with MYC, including promotion of apoptosis, alteration of morphology, enhancement of anchorage-independent growth, tumorigenic conversion, promotion of genomic instability and inhibition of hematopoietic differentiation.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...