Rgs10 (NM_026418) Mouse Untagged Clone

CAT#: MC210637

Rgs10 (untagged) - Mouse regulator of G-protein signalling 10 (Rgs10), (10ug)



  "NM_026418" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal anti-Rgs10 antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310010N19Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210637 representing NM_026418
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCACCCGCGCCGTGAGCCGACTGAGCAGGAAGCGGCCGCCGTCTGATATCCATGACGGAGATGGGA
GCTCAAGCAGCGGCCACCAGAGCCTTAAGAGCACAGCCAAGTGGGCATCCTCCCTGGAGAATCTTCTGGA
AGACCCAGAAGGGGTGCAGAGATTCAGGGAGTTTCTGAAGAAGGAATTCAGCGAAGAGAATGTCTTGTTT
TGGCTAGCGTGTGAAGATTTCAAGAAAACGGAGGACAGGAAGCAGATGCAGGAAAAGGCCAAGGAGATCT
ACATGACCTTCCTGTCCAATAAGGCCTCTTCACAAGTCAACGTGGAGGGGCAGTCTCGGCTCACTGAAAA
GATTCTGGAAGAGCCACACCCTCTGATGTTCCAAAAGCTCCAGGACCAGATCTTCAATCTCATGAAGTAT
GACAGCTACAGCCGCTTCTTGAAGTCTGACTTGTTTCTGAAACCCAAGCGAACTGAGGAAGAGGAAGAAG
AGCCCCCGGATGCTCAGACCGCAGCTAAGCGAGCCTCCAGAATTTACAACACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026418
Insert Size 546 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_026418.2, NP_080694.1
RefSeq Size 875 bp
RefSeq ORF 546 bp
Locus ID 67865
UniProt ID Q9CQE5
Gene Summary Regulates G protein-coupled receptor signaling cascades, including signaling downstream of the muscarinic acetylcholine receptor CHRM2. Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Modulates the activity of potassium channels that are activated in response to CHRM2 signaling. Activity on GNAZ is inhibited by palmitoylation of the G-protein.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...