United States
Germany
Japan
United Kingdom
China
Trmt112 (NM_001166370) Mouse Untagged Clone
CAT＃: MC210596
Trmt112 (untagged) - Mouse tRNA methyltransferase 11-2 homolog (S. cerevisiae) (Trmt112), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610038D11Rik; Trm112p |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210596 representing NM_001166370
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAACTGCTCACCCACAATCTCCTAAGCTCCCATGTGCGGGGCGTGGGCACGCGTGGCTTCCCGCTGC GCCTGCAGGCCACTGAGGTCCGCATCAACCCCGTGGAGTTCAACCCGGAGTTCGTGGCGCGGATGATCCC CAAAGTGGAGTGGGCGGCGCTTGTGCAGGCAGCGGACACCTTAAACTTGGCCGAGGTACCCAAAGAGCCG ACTGAAGGCTATGAGCACGACGAGACATTTTTGAGGAAGATGCACCACGTGTTGCTTGAGGTTGATGTAC TGGAGGGCACCCTGCAATGCCCAGAATCTGGTCGTCTTTTCCCCATCAGCCGCGGGATCCCCAATATGCT GTTGAATGATGAGGAGACTGAGACGTAA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-RsrII |
| ACCN | NM_001166370 |
| Insert Size | 378 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001166370.1, NP_001159842.1 |
| RefSeq Size | 1047 bp |
| RefSeq ORF | 378 bp |
| Locus ID | 67674 |
| UniProt ID | Q9DCG9 |
| Gene Summary | Acts as an activator of both rRNA/tRNA and protein methyltransferases (PubMed:26797129). Together with methyltransferase BUD23, methylates the N(7) position of a guanine in 18S rRNA (By similarity). The heterodimer with HEMK2/N6AMT1 catalyzes N5-methylation of ETF1 on 'Gln-185', using S-adenosyl L-methionine as methyl donor (PubMed:20606008, PubMed:26797129). The heterodimer with ALKBH8 catalyzes the methylation of 5-carboxymethyl uridine to 5-methylcarboxymethyl uridine at the wobble position of the anticodon loop in target tRNA species (By similarity). Involved in the pre-rRNA processing steps leading to small-subunit rRNA production (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer and more frequently occurring transcript. Both variants encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG219242 | Trmt112 (tGFP-tagged) - Mouse tRNA methyltransferase 11-2 homolog (S. cerevisiae) (Trmt112) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
| MR219242 | Trmt112 (Myc-DDK-tagged) - Mouse tRNA methyltransferase 11-2 homolog (S. cerevisiae) (Trmt112), transcript variant 1 |
CNY 1,200.00 |
|
| MR219242L3 | Lenti ORF clone of Trmt112 (Myc-DDK-tagged) - Mouse tRNA methyltransferase 11-2 homolog (S. cerevisiae) (Trmt112), transcript variant 1 |
CNY 4,750.00 |
|
| MR219242L4 | Lenti ORF clone of Trmt112 (mGFP-tagged) - Mouse tRNA methyltransferase 11-2 homolog (S. cerevisiae) (Trmt112), transcript variant 1 |
CNY 4,750.00 |
其它Trmt112产品
