United States
Germany
Japan
United Kingdom
China
Map1lc3a (NM_025735) Mouse Untagged Clone
CAT＃: MC210426
Map1lc3a (untagged) - Mouse microtubule-associated protein 1 light chain 3 alpha (Map1lc3a), (10ug)
CNY 1,800.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1010001H21Rik; 4922501H04Rik; LC3; LC3a |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210426 representing NM_025735
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCTCCGACCGGCCTTTCAAGCAGCGGCGCAGCTTCGCCGACCGCTGTAAGGAGGTGCAGCAGATCC GCGACCAGCACCCCAGTAAGATCCCGGTGATCATCGAGCGCTACAAGGGTGAGAAGCAGCTGCCTGTCCT GGATAAGACCAAGTTTCTGGTCCCAGACCATGTTAACATGAGCGAGTTGGTCAAGATCATCCGGCGCCGC CTGCAACTCAACCCCACGCAGGCCTTCTTCCTGCTGGTCAACCAGCACAGCATGGTGAGCGTCTCCACAC CCATCGCTGACATCTATGAACAGGAGAAGGATGAAGACGGATTCCTCTACATGGTCTACGCCTCCCAAGA AACCTTCGGCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_025735 |
| Insert Size | 366 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_025735.3, NP_080011.1 |
| RefSeq Size | 1063 bp |
| RefSeq ORF | 366 bp |
| Locus ID | 66734 |
| UniProt ID | Q91VR7 |
| Gene Summary | Ubiquitin-like modifier involved in formation of autophagosomal vacuoles (autophagosomes). Whereas LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and is the protein-coding transcript. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227566 | Map1lc3a (tGFP-tagged) - Mouse microtubule-associated protein 1 light chain 3 alpha (Map1lc3a), (10ug) |
CNY 3,400.00 |
|
| MR227566 | Map1lc3a (Myc-DDK-tagged) - Mouse microtubule-associated protein 1 light chain 3 alpha (Map1lc3a) |
CNY 1,800.00 |
|
| MR227566L3 | Lenti ORF clone of Map1lc3a (Myc-DDK-tagged) - Mouse microtubule-associated protein 1 light chain 3 alpha (Map1lc3a) |
CNY 5,890.00 |
|
| MR227566L4 | Lenti ORF clone of Map1lc3a (mGFP-tagged) - Mouse microtubule-associated protein 1 light chain 3 alpha (Map1lc3a) |
CNY 5,890.00 |
其它Map1lc3a产品
