Nosip (NM_025533) Mouse Untagged Clone

CAT#: MC210357

Nosip (untagged) - Mouse nitric oxide synthase interacting protein (Nosip), transcript variant 1, (10ug)



  "NM_025533" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310061K06Rik; CGI-25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210357 representing NM_025533
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACGCGGCATGGCAAGAACTGCACTGCAGGGGCCGTCTACACCTACCACGAGAAGAAGAAGGACACAG
CGGCCTCGGGCTATGGGACCCAGAACATTCGACTGAGCCGGGACGCTGTGAAAGACTTTGACTGCTGCTG
TCTCTCTCTGCAGCCCTGCCATGACCCTGTGGTCACGCCAGACGGCTACCTGTATGAGAGGGAAGCGATC
CTGGAGTACATCCTGCACCAGAAGAGAGAGATCGCCCGGCAGGTGAAGGCCTATGAGAAGCAGCGAGGAG
CGAGGAGAGAAGAGCAGAAAGAGCTGCAGCGAGCTGCAGCCCAGGACCAAGTTAGAGGCTTCCTAGAGAA
GGAGGCGGCCATCGTGAGCCGGCCCCTCAACCCCTTCATGCCCAAGGCTGCCACCTTGCCCAACACAGAG
GGTGAACAGCCAGGGCCCAGTGTGGGTCCCGTAGGCAAGGACAAGGACAAAGCACTGCCCAGCTTCTGGA
TTCCCTCACTAACGCCCGAGGCAAAGGCCACCAAGCTGGAAAAGCCGTCCCGCACGGTGACCTGCCCGAT
GTCCGGGAAGCCACTGCGCATGTCGGACCTGACGTCAGTGCGCTTCACGCAGCTGGACGACTCTGTGGAC
CGCGTGGGACTCATCACACGCAGTGAGCGCTACGTTTGCGCAGTGACCCGAGACAGTCTGAGCAATGCCA
CGCCGTGCGCAGTGCTGCGTCCCTCTGGGGCTGTGGTCACCCTGGAGTGTGTTGAGAAACTGATCCGGAA
GGACATGGTGGACCCCGTGAATGGGGACACGCTGACAGAGCGCGACATCATCGTGCTGCAGCGGGGCGGC
ACCGGCTTTGCGGGCTCCGGAGTGAAGCTACAGGCAGAAATGTCTCGGCCAGTGATGCAGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025533
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_025533.3, NP_079809.1
RefSeq Size 2134 bp
RefSeq ORF 906 bp
Locus ID 66394
UniProt ID Q9D6T0
Gene Summary E3 ubiquitin-protein ligase that is essential for proper development of the forebrain, the eye and the face. Catalyzes monoubiquitination of serine/threonine-protein phosphatase 2A (PP2A) catalytic subunit PPP2CA/PPP2CB (PubMed:25546391). Negatively regulates nitric oxide production by inducing NOS1 and NOS3 translocation to actin cytoskeleton and inhibiting their enzymatic activity (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...