Smim20 (NM_001145433) Mouse Untagged Clone
CAT#: MC210317
Smim20 (untagged) - Mouse RIKEN cDNA 1810013D10 gene (1810013D10Rik), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110067B18Rik; 1810013D10Rik; N28078 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210317 representing NM_001145433
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCGGCCCGGAACCTGCGCACCGCGCTCATATTCGGAGGCTTCATCTCCATGGTCGGCGCCGCCT TCTATCCCATCTACTTCCGGCCCCTTATGCGGCTGGAGGAATACCAGAAGGAGCAGGCTGTAAATCGAGC TGGTATTGTCCAGGAAGATGTGCAACCGCCAGGGTTGAAAGTGTGGTCTGATCCATTTGGCAGGAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145433 |
Insert Size | 210 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145433.1, NP_001138905.1 |
RefSeq Size | 1036 bp |
RefSeq ORF | 210 bp |
Locus ID | 66278 |
UniProt ID | D3Z7Q2 |
Gene Summary | Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, that regulates cytochrome c oxidase assembly (By similarity). Promotes the progression of complex assembly after the association of MT-CO1/COX1 with COX4I1 and COX6C (By similarity). Chaperone-like assembly factor required to stabilize newly synthesized MT-CO1/COX1 and to prevent its premature turnover (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG212796 | 1810013D10Rik (tGFP-tagged) - Mouse RIKEN cDNA 1810013D10 gene (1810013D10Rik), (10ug) |
CNY 2,850.00 |
|
MR212796 | 1810013D10Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1810013D10 gene (1810013D10Rik) |
CNY 1,200.00 |
|
MR212796L3 | Lenti ORF clone of 1810013D10Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1810013D10 gene (1810013D10Rik) |
CNY 4,750.00 |
|
MR212796L4 | Lenti ORF clone of 1810013D10Rik (mGFP-tagged) - Mouse RIKEN cDNA 1810013D10 gene (1810013D10Rik) |
CNY 4,750.00 |