S100a14 (NM_001163525) Mouse Untagged Clone

CAT#: MC210290

S100a14 (untagged) - Mouse S100 calcium binding protein A14 (S100a14), transcript variant 1, (10ug)



  "NM_001163525" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110013O05Rik; S100a15; S114
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210290 representing NM_001163525
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGACAGTGTCGGTCAGCCAATGCTGAGGATGCCCAAGAATTCAGTGATGTAGAGAGGGCCATTGAGA
CACTCATCAAGAACTTCCATAAATACTCTGTGGCGGGTAAAAAGGAAACACTGACCCCTGCTGAGCTTCG
AGACCTGGTTACCCAGCAGCTGCCACACCTCATGCCGAGCAACTGTGGGTTAGAAGAGAAAATTGCCAAC
CTGGGCAACTGTAATGACTCGAAACTGGAGTTTGGAAGCTTCTGGGAGTTGATTGGAGAAGCAGCCAAGA
GTGTGAAGATGGAGAGGCCTGTTACTCGGAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001163525
Insert Size 315 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001163525.2, NP_001156997.1
RefSeq Size 1097 bp
RefSeq ORF 315 bp
Locus ID 66166
UniProt ID Q9D2Q8
Gene Summary Modulates P53/TP53 protein levels, and thereby plays a role in the regulation of cell survival and apoptosis. Depending on the context, it can promote cell proliferation or apoptosis. Plays a role in the regulation of cell migration by modulating the levels of MMP2, a matrix protease that is under transcriptional control of P53/TP53. Does not bind calcium (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...