Klk11 (NM_019974) Mouse Untagged Clone

CAT#: MC210072

Klk11 (untagged) - Mouse kallikrein related-peptidase 11 (Klk11), transcript variant 2, (10ug)



  "NM_019974" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310015I08Rik; hi; Pr; Prss20; T; TLSP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210072 representing NM_019974
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTCTCCGACTCATTGCACTTGCTCTGGTAACAGGGCACGTAGGGGGAGAGACGAGGATCATCAAGG
GTTATGAGTGCAGGCCTCACTCACAGCCATGGCAGGTGGCCCTCTTTCAGAAGACACGGCTTCTCTGTGG
GGCAACCCTCATCGCCCCCAAATGGCTCCTGACAGCAGCCCACTGCCGCAAGCCCCATTACGTGATCCTC
CTTGGAGAGCACAATCTAGAGAAGACAGACGGCTGTGAGCAGAGGCGGATGGCCACTGAGTCCTTCCCCC
ACCCCGACTTCAACAACAGCCTCCCCAACAAAGACCACCGGAATGACATAATGCTTGTGAAGATGTCGTC
TCCCGTCTTCTTTACCCGAGCTGTGCAGCCACTCACCCTGTCCCCACACTGTGTCGCTGCAGGCACCAGC
TGCCTCATTTCTGGATGGGGCACCACGTCCAGCCCCCAGTTGCGCCTGCCTCATTCCTTGCGATGTGCCA
ATGTCTCCATCATCGAACACAAGGAGTGTGAGAAGGCCTACCCGGGCAACATCACAGACACCATGCTGTG
CGCCAGTGTTCGGAAAGAGGGCAAGGACTCCTGTCAGGGTGACTCTGGAGGCCCCCTGGTCTGCAACGGA
TCTCTTCAAGGCATCATCTCCTGGGGTCAGGACCCATGTGCCGTCACCAGAAAGCCTGGTGTCTATACAA
AAGTCTGCAAATACTTTAACTGGATCCACGAGGTTATGAGGAACAATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019974
Insert Size 750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019974.2, NP_064358.1
RefSeq Size 1285 bp
RefSeq ORF 750 bp
Locus ID 56538
UniProt ID Q9QYN3
Gene Summary This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]
Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR and uses a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...