Cldn14 (NM_001165925) Mouse Untagged Clone
CAT#: MC210021
Cldn14 (untagged) - Mouse claudin 14 (Cldn14), transcript variant 2, (10ug)
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI851731 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210021 representing NM_001165925
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAGCACAGCGGTCCAGCTCCTAGGCTTCCTGCTTAGCTTCCTGGGCATGGTAGGAACGCTCATCA CCACCATCCTGCCACACTGGCGGAGGACGGCCCATGTGGGCACCAACATCCTGACTGCCGTATCCTACCT GAAGGGACTGTGGATGGAATGTGTGTGGCACAGCACAGGCATCTACCAGTGTCAGATCTACCGCTCACTG CTGGCGCTGCCCCGGGACTTGCAGGCCGCCCGGGCGCTCATGGTCATCTCCTGCCTGTTGTCGGGCATGG CCTGCGCCTGCGCAGTAGTGGGCATGAAGTGCACACGCTGCGCCAAAGGCACACCCGCCAAGACCACCTT TGCAGTGCTGGGGGGCGCGCTCTTCCTGCTGGCCGGCCTGCTGTGCATGGTGGCCGTGTCCTGGACCACG AATGACGTGGTGCAGAATTTTTATAACCCGCTGCTGCCCAGTGGCATGAAGTTTGAAATCGGCCAGGCCC TGTACCTGGGCTTCATCTCCTCATCCCTGTCTCTCATCGGGGGCACCCTGCTCTGCTTATCCTGCCAGGA CGAGGCCCCCTACAGACCCTACCCGCCCCAGTCCAGGGCCGGAGCTACCACCACGGCTACCGCCCCTGCC TACCGCCCACCAGCGGCCTACAAGGACAACCGTGCCCCCTCGGTGACCTCAGCCGCGCACAGTGGGTACA GGCTGAATGACTACGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001165925 |
Insert Size | 720 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001165925.1, NP_001159397.1 |
RefSeq Size | 1283 bp |
RefSeq ORF | 720 bp |
Locus ID | 56173 |
UniProt ID | Q9Z0S3 |
Gene Summary | This gene encodes a member of the claudin family of tight junction proteins. The encoded protein is an integral membrane protein that may function in maintaining apical membrane polarization in tight junctions located between outer hair cells and supporting cells. Loss of function of this gene is associated with hearing problems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Activation of the Ca2+-sensing receptor increases renal claudin-14 expression and urinary Ca2+ excretion
,Henrik Dimke, Prajakta Desai, Jelena Borovac, Alyssa Lau, Wanling Pan, and R. Todd Alexander,
Am J Physiol Renal Physiol, Mar 2013; 304: F761 - F769.
[Cldn14]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225403 | Cldn14 (tGFP-tagged) - Mouse claudin 14 (Cldn14) transcript variant 2, (10ug) |
CNY 2,850.00 |
|
MR225403 | Cldn14 (Myc-DDK-tagged) - Mouse claudin 14 (Cldn14), transcript variant 2 |
CNY 2,400.00 |
|
MR225403L3 | Lenti ORF clone of Cldn14 (Myc-DDK-tagged) - Mouse claudin 14 (Cldn14), transcript variant 2 |
CNY 4,750.00 |
|
MR225403L4 | Lenti ORF clone of Cldn14 (mGFP-tagged) - Mouse claudin 14 (Cldn14), transcript variant 2 |
CNY 4,750.00 |