Cadm1 (NM_001025600) Mouse Untagged Clone

CAT#: MC209995

Cadm1 (untagged) - Mouse cell adhesion molecule 1 (Cadm1), transcript variant 4, (10ug)



  "NM_001025600" in other vectors (4)

CNY 3,990.00


货期*
6周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Anti-CADM1/TSLC1 Antibody
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2900073G06Rik; 3100001I08Rik; AI987920; Bl2; Igsf4; Igsf4a; Necl2; RA175; RA175A; RA175B; RA175C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209995 representing NM_001025600
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGAGTGCTGTGCTGCCGAGCGGATCCCAGTGTGCGGCGGCAGCGGCTGTGGCGGCGGCGGCGGCGC
CTCCAGGGCTCCGGCTCCGGCTCCTGCTGTTGCTCCTTTCGGCCGCGGCACTGATCCCCACAGGTGATGG
ACAGAATCTGTTTACTAAAGACGTGACAGTGATTGAAGGAGAAGTGGCAACCATCAGCTGCCAGGTCAAT
AAGAGTGACGACTCAGTGATCCAGCTCCTGAACCCCAACAGGCAGACCATTTACTTCAGGGACTTCAGGC
CTTTGAAGGACAGCAGGTTTCAGCTGCTGAATTTTTCTAGCAGTGAACTCAAAGTGTCACTGACGAATGT
CTCAATCTCGGATGAAGGGAGATACTTCTGCCAGCTCTACACGGACCCCCCACAGGAGAGTTACACCACC
ATCACAGTCCTGGTTCCTCCACGTAACTTGATGATCGATATCCAGAAAGACACGGCAGTTGAAGGGGAGG
AGATTGAAGTCAACTGTACTGCCATGGCCAGCAAGCCAGCGACGACCATCAGGTGGTTCAAAGGGAACAA
GGAACTCAAAGGCAAATCAGAGGTGGAGGAGTGGTCGGACATGTACACTGTGACCAGTCAGCTGATGCTG
AAGGTGCACAAGGAGGACGACGGGGTCCCGGTGATCTGCCAGGTGGAGCACCCTGCGGTCACTGGAAACC
TGCAGACCCAGCGCTATCTAGAAGTGCAGTATAAACCGCAAGTGCATATCCAGATGACTTACCCTCTGCA
AGGCCTAACCCGGGAAGGGGATGCATTTGAGTTAACGTGTGAAGCCATCGGGAAGCCCCAGCCTGTGATG
GTAACTTGGGTGAGAGTCGATGATGAAATGCCTCAACATGCCGTACTGTCTGGGCCAAACCTGTTCATCA
ATAACCTAAACAAAACAGATAACGGTACTTACCGCTGTGAGGCTTCCAACATAGTGGGAAAGGCTCATTC
GGACTATATGCTGTATGTATACGATTCTCGAGCAGGTGAAGAGGGGACCATTGGGGCAGTGGACCACGCA
GTGATTGGTGGCGTCGTAGCCGTGGTGGTGTTTGCCATGCTATGCTTGCTCATCATTCTGGGCCGCTATT
TTGCCAGACATAAAGGTACATACTTCACTCATGAAGCCAAAGGAGCCGATGACGCAGCAGACGCAGACAC
AGCTATAATCAATGCAGAAGGAGGACAGAACAACTCCGAAGAAAAGAAAGAGTACTTCATCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025600
Insert Size 1254 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001025600.1, NP_001020771.1
RefSeq Size 4270 bp
RefSeq ORF 1254 bp
Locus ID 54725
UniProt ID Q8R5M8
Gene Summary Mediates homophilic cell-cell adhesion in a Ca(2+)-independent manner. Also mediates heterophilic cell-cell adhesion with CADM3 and NECTIN3 in a Ca(2+)-independent manner. Acts as a tumor suppressor in non-small-cell lung cancer (NSCLC) cells. Interaction with CRTAM promotes natural killer (NK) cell cytotoxicity and interferon-gamma (IFN-gamma) secretion by CD8+ cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM3 in vivo. May contribute to the less invasive phenotypes of lepidic growth tumor cells. In mast cells, may mediate attachment to and promote communication with nerves. CADM1, together with MITF, is essential for development and survival of mast cells in vivo. Acts as a synaptic cell adhesion molecule and plays a role in the formation of dendritic spines and in synapse assembly. May be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. May play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks two in-frame exons compared to variant 1. The resulting isoform (d) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...