Tollip (NM_023764) Mouse Untagged Clone

CAT#: MC209983

Tollip (untagged) - Mouse toll interacting protein (Tollip), (10ug)



  "NM_023764" in other vectors (4)

CNY 2,640.00

CNY 5,130.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Tollip Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4930403G24Rik; 4931428G15Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209983 representing NM_023764
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGACCACCGTCAGCACGCAGCGCGGGCCGGTGTACATTGGTGAACTCCCCCAGGACTTCCTCCGTA
TAACACCCACACAACAGCAGCAGCAGATCCAGCTGGATGCCCAGGCAGCCCAGCAGCTGCAGTATGGAGG
AACAGTTGGTACCGTGGGTCGCCTCAGCATCACTGTGGTACAGGCAAAATTGGCAAAGAATTATGGCATG
ACTCGTATGGACCCTTACTGCCGTCTGCGTCTGGGCTATGCTGTTTATGAAACTCCCACAGCACACAATG
GGGCCAAGAACCCTCGCTGGAACAAAGTCATTCAGTGCACAGTGCCCCCAGGTGTGGACTCGTTCTACCT
TGAGATCTTCGATGAGCGCGCCTTCTCCATGGATGACCGCATAGCTTGGACCCACATCACCATCCCCGAG
TCCCTGAAGCAGGGCCAAGTGGAGGACGAGTGGTATAGCCTGAGTGGGAGGCAGGGCGATGACAAGGAGG
GCATGATTAACCTGGTCATGTCCTACACGTCCCTCCCAGCTGCCATGATGATGCCTCCTCAGCCTGTGGT
CCTGATGCCAACTGTGTACCAGCAGGGTGTTGGCTATGTGCCCATTGCAGGGATGCCTGCTGTCTGCAGC
CCTGGCATGGTGCCGATGGCCATGCCCCCACCAGCTGTGGCTCCTCAGCCCCGCTGTAATGAAGAGGACC
TCAAAGCTATCCAGGACATGTTTCCCAACATGGACAGGGAAGTAATCCGTTCTGTGCTTGAAGCCCAGAG
AGGGAACAAAGATGCTGCCATCAATTCCTTGCTGCAAATGGGTGAAGAGTCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_023764
Insert Size 825 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_023764.3, NP_076253.1
RefSeq Size 3705 bp
RefSeq ORF 825 bp
Locus ID 54473
UniProt ID Q9QZ06
Gene Summary Component of the signaling pathway of IL-1 and Toll-like receptors. Inhibits cell activation by microbial products. Recruits IRAK1 to the IL-1 receptor complex. Inhibits IRAK1 phosphorylation and kinase activity. Connects the ubiquitin pathway to autophagy by functioning as a ubiquitin-ATG8 family adapter and thus mediating autophagic clearance of ubiquitin conjugates. The TOLLIP-dependent selective autophagy pathway plays an important role in clearance of cytotoxic polyQ proteins aggregates (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...