Il1f5 (NM_001146087) Mouse Untagged Clone
CAT#: MC209981
Il1f5 (untagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 1, (10ug)
CNY 1,800.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI413231; Fil1delta; Il-1h3; IL-36Ra; Il1hy1; IL36RN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001146087, the custom clone sequence may differ by one or more nucleotides
ATGGTTCTGAGTGGGGCACTATGCTTCCGAATGAAGGATTCAGCCTTGAAGGTACTGTATCTGCACAATA ACCAGCTGCTGGCTGGAGGACTGCACGCAGAGAAGGTCATTAAAGGTGAGGAGATCAGTGTTGTCCCAAA TCGGGCACTGGATGCCAGTCTGTCCCCTGTCATCCTGGGCGTTCAAGGAGGAAGCCAGTGCCTATCTTGT GGGACAGAGAAAGGGCCAATTCTGAAACTTGAGCCAGTGAACATCATGGAGCTCTACCTCGGGGCCAAGG AATCAAAGAGCTTCACCTTCTACCGGCGGGATATGGGTCTTACCTCCAGCTTCGAATCCGCTGCCTACCC AGGCTGGTTCCTCTGCACCTCACCGGAAGCTGACCAGCCTGTCAGGCTCACTCAGATCCCTGAGGACCCC GCCTGGGATGCTCCCATCACAGACTTCTACTTTCAGCAGTGTGACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146087 |
Insert Size | 468 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC132600, AAI32601 |
RefSeq Size | 719 bp |
RefSeq ORF | 471 bp |
Locus ID | 54450 |
UniProt ID | Q9QYY1 |
Gene Summary | Inhibits the activity of interleukin-36 (IL36A,IL36B and IL36G) by binding to receptor IL1RL2/IL-36R and preventing its association with the coreceptor IL1RAP for signaling. Part of the IL-36 signaling system that is thought to be present in epithelial barriers and to take part in local inflammatory response; similar to the IL-1 system with which it shares the coreceptor. Proposed to play a role in skin inflammation. May be involved in the innate immune response to fungal pathogens. May activate an anti-inflammatory signaling pathway by recruiting SIGIRR.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG219404 | Il1f5 (tGFP-tagged) - Mouse interleukin 1 family member 5 (delta) (Il1f5) transcript variant 1, (10ug) |
CNY 3,520.00 |
|
MR219404 | Il1f5 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 1 |
CNY 1,920.00 |
|
MR219404L3 | Lenti ORF clone of Il1f5 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 1 |
CNY 4,750.00 |
|
MR219404L4 | Lenti ORF clone of Il1f5 (mGFP-tagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 1 |
CNY 4,750.00 |