Sap30l (NM_001081168) Mouse Untagged Clone

CAT#: MC209861

Sap30l (untagged) - Mouse SAP30-like (Sap30l), (10ug)



  "NM_001081168" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Anti-Sap30L Antibody
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310079P12Rik; AF006998; L55
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209861 representing NM_001081168
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACGGCTTCAGCACAGAGGAGGACAGCCGCGAAGGGCCCCCTGCCGCCCCCGCCGCCGCCCCGGGCT
ACGGCCAGAGCTGCTGCCTCATCGCGGACGGCGAGCGCTGCGTCCGGCCCGCGGGCAACGCCTCCTTCAG
CAAGAGGGTGCAGAAAAGCATCTCGCAGAAGAAACTCAAGCTGGACATAGACAAGAGCGTAAGGCACCTG
TATATCTGCGACTTCCACAAAAATTTCATCCAGAGCGTCCGAAATAAAAGGAAGAGGAAGGCAAGTGACG
ATGGCGGAGACTCCCCCGAGCACGATGCTGACATCCCTGAGGTTGATCTGTTCCAGCTGCAGGTGAACAC
GCTCCGACGTTACAAACGGCACTATAAGCTGCAGACCAGACCAGGCTTCAACAAGGCCCAGCTAGCAGAG
ACTGTGAGCCGACACTTCAGGAACATACCAGTGAATGAGAAAGAGACGCTTGCCTATTTCATCTACATGG
TGAAGAGTAACAGGAGCAGACTGGACCAGAAGTCAGAGGGCAGCAAGCAGCTTGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001081168
Insert Size 549 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001081168.1, NP_001074637.1
RefSeq Size 1549 bp
RefSeq ORF 549 bp
Locus ID 50724
UniProt ID Q5SQF8
Gene Summary Functions as transcription repressor, probably via its interaction with histone deacetylase complexes. Involved in the functional recruitment of the class 1 Sin3-histone deacetylase complex (HDAC) to the nucleolus. Binds DNA, apparently without sequence-specificity, and bends bound double-stranded DNA. Binds phosphoinositol phosphates (phosphoinositol 3-phosphate, phosphoinositol 4-phosphate and phosphoinositol 5-phosphate) via the same basic sequence motif that mediates DNA binding and nuclear import.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...