Siva1 (NM_001161737) Mouse Untagged Clone
CAT#: MC209846
Siva1 (untagged) - Mouse SIVA1, apoptosis-inducing factor (Siva1), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CD27bp; Siva |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209846 representing NM_001161737
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCAAGCGGAGCTGCCCGTTCGCAGACGCAGCCCCGCTCCAACTCAAAGTCCACGTGGGCCTGAAAG AGCTGAGCCACGGTGTGTTCGCCGAGCGCTACTCACGCGAGGTCTTCGGCCTTCCCAGGACAGCGCCCAT CGCTTGTTCATCGTGCATGAGATCTGTGGATGGGAAGGCGGTCTGCAGCCAGTGCGAGCGGGCCCTGTGT GGGCAGTGTGTATACACCTGCTGGGGCTGCGGTGCTTTGGCCTGTGTGCTGTGTGGCCTTGCAGACTATG CCGACGATGGTGAGAAGACACTGTGCACCAGCTGTGCTATGTTTGAAGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001161737 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001161737.1, NP_001155209.1 |
RefSeq Size | 587 bp |
RefSeq ORF | 333 bp |
Locus ID | 30954 |
UniProt ID | O54926 |
Gene Summary | Induces CD27-mediated apoptosis. Inhibits BCL2L1 isoform Bcl-x(L) anti-apoptotic activity. Inhibits activation of NF-kappa-B and promotes T-cell receptor-mediated apoptosis (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218284 | Siva1 (tGFP-tagged) - Mouse SIVA1 apoptosis-inducing factor (Siva1) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
MR218284 | Siva1 (Myc-DDK-tagged) - Mouse SIVA1, apoptosis-inducing factor (Siva1), transcript variant 2 |
CNY 1,900.00 |
|
MR218284L3 | Lenti ORF clone of Siva1 (Myc-DDK-tagged) - Mouse SIVA1, apoptosis-inducing factor (Siva1), transcript variant 2 |
CNY 3,800.00 |
|
MR218284L4 | Lenti ORF clone of Siva1 (mGFP-tagged) - Mouse SIVA1, apoptosis-inducing factor (Siva1), transcript variant 2 |
CNY 3,800.00 |