Pla2g10 (NM_011987) Mouse Untagged Clone
CAT#: MC209741
Pla2g10 (untagged) - Mouse phospholipase A2, group X (Pla2g10), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | GX sPLA2; mGXs; PLA; PLA2GX; sPLA2-X |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209741 representing NM_011987
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCTGCTACTGCTGCTGTTGCTGCTGGGACCTGGACCCGGATTCAGCGAAGCAACCAGGAGGTCAC ATGTATACAAGCGTGGACTCCTGGAGCTGGCAGGGACCTTGGATTGTGTTGGGCCTCGATCTCCGATGGC TTACATGAACTATGGCTGTTATTGTGGCCTTGGTGGCCATGGAGAGCCACGTGACGCCATTGACTGGTGC TGCTACCACCACGACTGCTGCTACTCTCGGGCTCAGGACGCTGGCTGCAGCCCTAAGTTAGACCGCTACC CATGGAAGTGCATGGACCATCACATCCTGTGTGGACCAGCAGAGAACAAATGCCAAGAACTTTTGTGCAG GTGTGACGAGGAGCTGGCTTACTGCCTGGCAGGGACCGAGTACCACCTGAAATACCTCTTCTTCCCCTCC ATTTTATGTGAGAAGGACTCTCCCAAGTGCAATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011987 |
Insert Size | 456 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_011987.4, NP_036117.1 |
RefSeq Size | 926 bp |
RefSeq ORF | 456 bp |
Locus ID | 26565 |
UniProt ID | Q9QXX3 |
Gene Summary | This gene encodes a member of the phospholipase A2 family of lipolytic enzymes that hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids. The encoded protein undergoes proteolytic processing to generate a calcium-dependent enzyme that plays pivotal roles in the liberation of arachidonic acid from membrane phospholipids leading to the production of various inflammatory lipid mediators, such as prostaglandins. In response to myocardial ischemia/reperfusion, mice lacking the encoded protein display a reduction in myocardial infarct size partly through the suppression of neutorphil cytotoxic activities. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (1) represents the shortest transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226157 | Pla2g10 (tGFP-tagged) - Mouse phospholipase A2 group X (Pla2g10), (10ug) |
CNY 4,370.00 |
|
MR226157 | Pla2g10 (Myc-DDK-tagged) - Mouse phospholipase A2, group X (Pla2g10) |
CNY 1,800.00 |
|
MR226157L3 | Lenti ORF clone of Pla2g10 (Myc-DDK-tagged) - Mouse phospholipase A2, group X (Pla2g10) |
CNY 5,890.00 |
|
MR226157L4 | Lenti ORF clone of Pla2g10 (mGFP-tagged) - Mouse phospholipase A2, group X (Pla2g10) |
CNY 5,890.00 |
其它Pla2g10产品