Dand5 (NM_201227) Mouse Untagged Clone
CAT#: MC209677
Dand5 (untagged) - Mouse DAN domain family, member 5 (Dand5), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Cerl-2; Cerr2; coco; Dte; GREM3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209677 representing NM_201227
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCCGTAGCCAGTTCACCACGCTGCTGGGTCTGTTCAGTGGGGCCTGGCTACCCACAGGCTCAGGGA GGCCTGGGGCCCCAGCGACCCCTGTTCAGTCCGGGACTGCTATCAATCAGAGCTGGACTCTGGATCCCCT GGTGCCCATCTCTGCCCTGGGTAGCTGGGAGGCCTTCCTGGGCCTGCAGAACAAACAGCAGGGGACAGGT GAGCTGCAGGGAGGAGGGCAGAGAGTAGCTGCTGGTGTGCCTTTGCCCTTGGCTCCTCAAGAAGTGCTTC AGGAGACTTGTAAAGCTCTGTCCTTTGTTCAGGTGATCTCCAGGCCTGGTTGCACAAGTGCCCGGGTCCT TAATCATCTCTGTTTTGGCCGCTGTTCCTCCTTCTACATTCCCAGCTCGGATCCCACCCCTGTAGTCTTC TGCAACAGCTGTGTGCCGGCTCGAAAGCGCTGGACATCGGTGACGCTGTGGTGTGGAGCTGGCCAATTAG CCTCCCCTCGGCGGGTGAGGATTTCCACGGTATTGGTCCAGAAGTGTCAGTGCCGCCCGAAGCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_201227 |
Insert Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_201227.3, NP_957679.1 |
RefSeq Size | 1584 bp |
RefSeq ORF | 558 bp |
Locus ID | 23863 |
UniProt ID | Q76LW6 |
Gene Summary | Seems to play a role in the correct specification of the left-right axis. May antagonize NODAL and BMP4 signaling. Cystine knot-containing proteins play important roles during development, organogenesis, and tissue growth and differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and is the protein-coding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226975 | Dand5 (tGFP-tagged) - Mouse DAN domain family member 5 (Dand5) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR226975 | Dand5 (Myc-DDK-tagged) - Mouse DAN domain family, member 5 (Dand5), transcript variant 1 |
CNY 2,400.00 |
|
MR226975L3 | Lenti ORF clone of Dand5 (Myc-DDK-tagged) - Mouse DAN domain family, member 5 (Dand5), transcript variant 1 |
CNY 4,750.00 |
|
MR226975L4 | Lenti ORF clone of Dand5 (mGFP-tagged) - Mouse DAN domain family, member 5 (Dand5), transcript variant 1 |
CNY 4,750.00 |