Ube2i (NM_001177610) Mouse Untagged Clone
CAT#: MC209611
Ube2i (untagged) - Mouse ubiquitin-conjugating enzyme E2I (Ube2i), transcript variant 3, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 5830467E05Rik; F830028O17Rik; UBC9; Ubce2i; Ubce9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209611 representing NM_001177610
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGGGATCGCCCTCAGCCGCCTTGCGCAGGAAAGGAAAGCCTGGAGGAAGGACCACCCTTTTGGCT TTGTAGCTGTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCTGG AAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCC TCACCACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCC TGTCCATCCTGGAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACA AGAACTTCTAAATGAACCAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAAC AGAGTGGAATATGAGAAAAGGGTCCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177610 |
Insert Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001177610.1, NP_001171081.1 |
RefSeq Size | 2516 bp |
RefSeq ORF | 477 bp |
Locus ID | 22196 |
UniProt ID | P63280 |
Gene Summary | Accepts the ubiquitin-like proteins SUMO1, SUMO2 and SUMO3 from the UBLE1A-UBLE1B E1 complex and catalyzes their covalent attachment to other proteins with the help of an E3 ligase such as RANBP2, CBX4 and ZNF451. Can catalyze the formation of poly-SUMO chains. Essential for nuclear architecture, chromosome segregation and embryonic viability. Necessary for sumoylation of FOXL2 and KAT5 (By similarity). Sumoylates p53/TP53 at 'Lys-386'.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 2. Variants 1-4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222626 | Ube2i (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2I (Ube2i) transcript variant 3, (10ug) |
CNY 2,850.00 |
|
MR222626 | Ube2i (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2I (Ube2i), transcript variant 3 |
CNY 1,200.00 |
|
MR222626L3 | Lenti ORF clone of Ube2i (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2I (Ube2i), transcript variant 3 |
CNY 4,750.00 |
|
MR222626L4 | Lenti ORF clone of Ube2i (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2I (Ube2i), transcript variant 3 |
CNY 4,750.00 |