Trex1 (NM_011637) Mouse Untagged Clone

CAT#: MC209585

Trex1 (untagged) - Mouse three prime repair exonuclease 1 (Trex1), transcript variant 1, (10ug)



  "NM_011637" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TREX1 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AU041952
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209585 representing NM_011637
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCTCACAGACCCTGCCCCATGGTCACATGCAGACCCTCATCTTCTTAGACCTGGAAGCCACTGGCC
TGCCTTCGTCTCGGCCCGAAGTCACAGAGCTGTGCCTGCTGGCTGTCCACAGACGTGCTCTGGAGAACAC
TTCCATTTCTCAGGGACATCCACCTCCAGTGCCCAGACCGCCCCGTGTGGTGGACAAGCTCTCTCTGTGC
ATTGCTCCAGGGAAAGCCTGTAGCCCTGGGGCCAGTGAGATCACAGGTCTGAGCAAAGCTGAGCTGGAAG
TACAGGGGCGTCAACGCTTCGATGACAACCTGGCCATCCTGCTCCGAGCCTTCCTGCAGCGCCAGCCACA
GCCTTGCTGCCTTGTGGCACACAACGGTGACCGCTATGACTTTCCTCTGCTCCAGACAGAGCTTGCTAGG
CTGAGCACTCCCAGTCCCCTAGATGGTACCTTCTGTGTGGACAGCATCGCTGCCCTAAAGGCCTTGGAAC
AAGCTAGCAGCCCCTCAGGGAATGGTTCGAGGAAAAGCTACAGCCTGGGCAGCATCTACACCCGCCTGTA
CTGGCAAGCACCGACAGACTCACATACTGCTGAAGGTGATGTTCTAACCCTGCTCAGCATCTGTCAGTGG
AAGCCACAGGCCCTACTGCAGTGGGTGGACGAACATGCCCGGCCCTTTAGCACCGTCAAGCCCATGTACG
GCACTCCGGCTACCACTGGAACAACCAACCTAAGGCCACATGCTGCCACAGCTACTACACCCCTGGCCAC
AGCCAATGGAAGTCCCAGCAATGGCAGGAGCAGGCGACCTAAGAGTCCTCCTCCAGAGAAGGTCCCAGAA
GCCCCATCACAGGAGGGGCTGCTGGCCCCACTGAGCCTGCTGACCCTCCTGACCTTGGCAATAGCCACTC
TGTATGGACTCTTCCTGGCCTCACCTGGGCAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011637
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011637.6, NP_035767.4
RefSeq Size 1074 bp
RefSeq ORF 945 bp
Locus ID 22040
UniProt ID Q91XB0
Gene Summary Major cellular 3'-to-5' DNA exonuclease which digests single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) with mismatched 3' termini. Prevents cell-intrinsic initiation of autoimmunity. Acts by metabolizing DNA fragments from endogenous retroelements, including L1, LTR and SINE elements. Unless degraded, these DNA fragments accumulate in the cytosol and activate the IFN-stimulatory DNA (ISD) response and innate immune signaling. Prevents chronic ATM-dependent checkpoint activation, by processing ssDNA polynucleotide species arising from the processing of aberrant DNA replication intermediates. Inefficiently degrades oxidized DNA, such as that generated upon antimicrobial reactive oxygen production or upon absorption of UV light. During GZMA-mediated cell death, contributes to DNA damage in concert with NME1. NME1 nicks one strand of DNA and TREX1 removes bases from the free 3' end to enhance DNA damage and prevent DNA end reannealing and rapid repair.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...