Cd40lg (NM_011616) Mouse Untagged Clone

CAT#: MC209552

Cd40lg (untagged) - Mouse CD40 ligand (Cd40lg), (10ug)



  "NM_011616" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Recombinant Anti-CD40L (Clone MR1)
    • 200 ug

CNY 7,170.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CD40-L; Cd40l; CD154; gp39; HIGM1; IGM; IMD3; Ly-62; Ly62; T-BAM; Tnfsf5; Tnlg8b; TRAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209552 representing NM_011616
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATAGAAACATACAGCCAACCTTCCCCCAGATCCGTGGCAACTGGACTTCCAGCGAGCATGAAGATTT
TTATGTATTTACTTACTGTTTTCCTTATCACCCAAATGATTGGATCTGTGCTTTTTGCTGTGTATCTTCA
TAGAAGATTGGATAAGGTCGAAGAGGAAGTAAACCTTCATGAAGATTTTGTATTCATAAAAAAGCTAAAG
AGATGCAACAAAGGAGAAGGATCTTTATCCTTGCTGAACTGTGAGGAGATGAGAAGGCAATTTGAAGACC
TTGTCAAGGATATAACGTTAAACAAAGAAGAGAAAAAAGAAAACAGCTTTGAAATGCAAAGAGGTGATGA
GGATCCTCAAATTGCAGCACACGTTGTAAGCGAAGCCAACAGTAATGCAGCATCCGTTCTACAGTGGGCC
AAGAAAGGATATTATACCATGAAAAGCAACTTGGTAATGCTTGAAAATGGGAAACAGCTGACGGTTAAAA
GAGAAGGACTCTATTATGTCTACACTCAAGTCACCTTCTGCTCTAATCGGGAGCCTTCGAGTCAACGCCC
ATTCATCGTCGGCCTCTGGCTGAAGCCCAGCAGTGGATCTGAGAGAATCTTACTCAAGGCGGCAAATACC
CACAGTTCCTCCCAGCTTTGCGAGCAGCAGTCTGTTCACTTGGGCGGAGTGTTTGAATTACAAGCTGGTG
CTTCTGTGTTTGTCAACGTGACTGAAGCAAGCCAAGTGATCCACAGAGTTGGCTTCTCATCTTTTGGCTT
ACTCAAACTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011616
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC119225, AAI19226
RefSeq Size 934 bp
RefSeq ORF 783 bp
Locus ID 21947
UniProt ID P27548
Gene Summary Cytokine that binds to CD40/TNFRSF5. Costimulates T-cell proliferation and cytokine production. Its cross-linking on T-cells generates a costimulatory signal which enhances the production of IL4 and IL10 in conjunction with the TCR/CD3 ligation and CD28 costimulation. Induces the activation of NF-kappa-B and kinases MAPK8 and PAK2 in T-cells (By similarity). Mediates B-cell proliferation in the absence of co-stimulus as well as IgE production in the presence of IL4. Involved in immunoglobulin class switching (PubMed:1374165).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...