Cd40 (NM_170703) Mouse Untagged Clone

CAT#: MC209545

Cd40 (untagged) - Mouse CD40 antigen (Cd40), transcript variant 2, (10ug)



  "NM_170703" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Recombinant Anti-CD40 (Clone FGK45)
    • 200 ug

CNY 7,170.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI326936; Bp50; GP39; HIGM1; IGM; IMD3; p50; T-BAM; Tnfrsf5; TRAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209545 representing NM_170703
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGTCTTTGCCTCGGCTGTGCGCGCTATGGGGCTGCTTGTTGACAGCGGTCCATCTAGGGCAGTGTG
TTACGTGCAGTGACAAACAGTACCTCCACGATGGCCAGTGCTGTGATTTGTGCCAGCCAGGAAGCCGACT
GACAAGCCACTGCACAGCTCTTGAGAAGACCCAATGCCACCCATGTGACTCAGGCGAATTCTCAGCCCAG
TGGAACAGGGAGATTCGCTGTCACCAGCACAGACACTGTGAACCCAATCAAGGGCTTCGGGTTAAGAAGG
AGGGCACCGCAGAATCAGACACTGTCTGTACCTGTAAGGAAGGACAACACTGCACCAGCAAGGATTGCGA
GGCATGTGCTCAGCACACGCCCTGTATCCCTGGCTTTGGAGTTATGGAGATGGCCACTGAGACCACTGAT
ACCGTCTGTCATCCCTGCCCAGTCGGCTTCTTCTCCAATCAGTCATCACTTTTCGAAAAGTGTTATCCCT
GGACAAGGTTTAAAGTCCCGGATGCGAGCCCTGCTGGTCATTCCTGTCGTGATGGGCATCCTCATCACCA
TTTTCGGGGTGTTTCTCTATATCAAAAAGGTGGTCAAGAAACCAAAGGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_170703
Insert Size 612 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_170703.2, NP_733804.1
RefSeq Size 1621 bp
RefSeq ORF 612 bp
Locus ID 21939
UniProt ID P27512
Gene Summary Receptor for TNFSF5/CD40LG. Transduces TRAF6- and MAP3K8-mediated signals that activate ERK in macrophages and B cells, leading to induction of immunoglobulin secretion.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (2), also known as type II, lacks an internal segment near the C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...