Alyref (NM_011568) Mouse Untagged Clone
CAT#: MC209512
Alyref (untagged) - Mouse THO complex 4 (Thoc4), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | ALY; Aly; REF1; Ref1; Ref1-I; Refbp1; Tho4; Thoc4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209512 representing NM_011568
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGACAAAATGGACATGTCTTTGGACGACATCATTAAGCTGAACCGGAGCCAGCGAGGAGGCCGCG GCGGGGGCCGGGGTCGCGGCAGGGCCGGCTCCCAGGGCGGCCGCGGCGGCGCAGTGCAGGCCGCCGCGCG GGTGAATCGAGGCGGCGGGCCTATGAGGAACCGGCCCGCCATCGCCCGCGGCGCCGCAGGCGGCGGCAGG AACCGGCCGGCGCCGTACAGCAGACCGAAACAACTTCCCGACAAATGGCAGCACGACCTCTTCGACAGCG GCTTCGGGGGTGGAGCCGGCGTGGAGACCGGCGGGAAGCTGCTGGTGTCCAACCTGGACTTCGGAGTGTC AGATGCTGATATTCAGGAACTCTTTGCTGAATTTGGGACATTGAAAAAAGCTGCTGTGCACTATGATCGC TCTGGACGAAGTTTAGGGACAGCAGATGTGCACTTTGAACGGAAAGCAGATGCCCTGAAGGCTATGAAAC AGTACAATGGTGTCCCTTTGGATGGCCGCCCTATGAACATCCAGCTTGTCACATCACAGATTGATACACA GCGAAGACCTGCACAGAGCATAAACAGAGGCGGCATGACAAGAAACCGTGGCTCTGGAGGTTTTGGTGGT GGTGGCACCAGGAGAGGGACACGTGGAGGCAGCCGGGGAAGAGGTAGAGGCACCGGCAGGAACTCAAAGC AGCAGCTTTCTGCAGAGGAGTTGGACGCACAGCTGGATGCTTACAATGCAAGGATGGACACCAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011568 |
Insert Size | 768 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_011568.1, NP_035698.1 |
RefSeq Size | 1132 bp |
RefSeq ORF | 768 bp |
Locus ID | 21681 |
UniProt ID | O08583 |
Gene Summary | Export adapter involved in nuclear export of spliced and unspliced mRNA. Binds mRNA which is thought to be transferred to the NXF1-NXT1 heterodimer for export (TAP/NFX1 pathway). Component of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and specifically associates with spliced mRNA and not with unspliced pre-mRNA. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm. TREX recruitment occurs via an interaction between ALYREF/THOC4 and the cap-binding protein NCBP1. Required for TREX complex assembly and for linking DDX39B to the cap-binding complex (CBC). In conjunction with THOC5 functions in NXF1-NXT1 mediated nuclear export of HSP70 mRNA; both proteins enhance the RNA binding activity of NXF1 and are required for NXF1 localization to the nuclear rim. Involved in the nuclear export of intronless mRNA; proposed to be recruited to intronless mRNA by ATP-bound DDX39B. Involved in transcription elongation and genome stability.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220236 | Alyref (tGFP-tagged) - Mouse THO complex 4 (Thoc4), (10ug) |
CNY 2,850.00 |
|
MR220236 | Alyref (Myc-DDK-tagged) - Mouse THO complex 4 (Thoc4) |
CNY 2,400.00 |
|
MR220236L3 | Lenti ORF clone of Alyref (Myc-DDK-tagged) - Mouse THO complex 4 (Thoc4) |
CNY 4,750.00 |
|
MR220236L4 | Lenti ORF clone of Alyref (mGFP-tagged) - Mouse THO complex 4 (Thoc4) |
CNY 4,750.00 |