Cox7a2l (NM_001159529) Mouse Untagged Clone
CAT#: MC209404
Cox7a2l (untagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l), nuclear gene encoding mitochondrial protein, transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | COX7AR; COX7RP; EB1; SIG-81; SIG81; Silg81 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209404 representing NM_001159529
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTACTACAAGTTTAGCAGTTTCACGCAGAAGTTGGCTGGAGCTTGGGCTTCGGAAGCCTACACCCCGC AGGGGTTAAAGCCAGTTTCCACAGAAGCACCACCTATCATATTTGCCACACCAACCAAACTGACCTCCAG TGTGACAGCATATGATTATTCTGGGAAGAACAAAGTTCCAGAGCTGCAGAAGTTTTTCCAGCCTCCTTTT CTTAAGGAGAACTCTTTACTTCAGTTTGGTCCGTTGGCTAATAATGGAACCTTTGTACAGAAGGCTGATG GTTTCCACCTGAAACGAGGCCTTCCAGACCAAATGCTTTACCGGACCACCATGGCTCTGACACTGGGAGG GACCATCTACTGCCTGATCGCCCTCTACATGGCCTCGCAGCCCAGAAACAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001159529 |
Insert Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001159529.1, NP_001153001.1 |
RefSeq Size | 1169 bp |
RefSeq ORF | 405 bp |
Locus ID | 20463 |
Gene Summary | Involved in the regulation of oxidative phosphorylation and energy metabolism (PubMed:23857330, PubMed:23812712). Necessary for the assembly of mitochondrial respiratory supercomplex (PubMed:23857330, PubMed:23812712).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224902 | Cox7a2l (tGFP-tagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l) nuclear gene encoding mitochondrial protein transcript variant 1, (10ug) |
CNY 2,800.00 |
|
MR224902 | Cox7a2l (Myc-DDK-tagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1,200.00 |
|
MR224902L3 | Lenti ORF clone of Cox7a2l (Myc-DDK-tagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,750.00 |
|
MR224902L4 | Lenti ORF clone of Cox7a2l (mGFP-tagged) - Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like (Cox7a2l), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,750.00 |
其它Cox7a2l产品