Srsf2 (NM_011358) Mouse Untagged Clone

CAT#: MC209382

Srsf2 (untagged) - Mouse serine/arginine-rich splicing factor 2 (Srsf2), (10ug)



  "NM_011358" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms D11Wsu175; D11Wsu175e; MRF-; MRF-1; Pr264; SC3; SC35; Sf; Sfr; Sfrs2; Sfrs10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209382 representing NM_011358
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCTACGGCCGCCCGCCTCCCGATGTGGAGGGCATGACCTCCCTCAAGGTGGACAACCTGACCTACC
GCACCTCGCCCGACACCCTGAGGCGCGTCTTCGAGAAATACGGGCGCGTCGGCGACGTGTACATTCCGCG
GGACCGCTACACCAAGGAGTCCCGGGGCTTCGCCTTCGTCCGGTTCCACGACAAGCGCGACGCCGAAGAC
GCCATGGACGCCATGGACGGGGCGGTGCTCGACGGCCGCGAGCTGCGGGTGCAGATGGCGCGCTACGGCC
GCCCGCCCGACTCGCACCACAGCCGCCGGGGCCCGCCACCCCGTCGGTACGGCGGCGGCGGCTACGGGCG
GCGGAGCCGCAGCCCTCGGCGACGCCGGCGCAGCCGATCTCGAAGCCGGAGTCGGTCCAGGTCGCGAAGC
CGCTCCCGCTACAGCCGCTCCAAGTCTCGGTCCCGCACTCGCTCGCGCTCCAGATCAACCTCCAAGTCCA
GATCTGCCCGAAGATCCAAGTCCAAGTCCTCCTCCGTCTCCAGATCCCGCTCGAGGTCAAGGTCCAGGTC
GCGATCGAGAAGCCCTCCGCCCGTGTCGAAGCGAGAGTCCAAGTCTAGGTCGCGGTCCAAGAGCCCACCC
AAGTCTCCAGAAGAAGAGGGAGCAGTTTCTTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011358
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011358.2, NP_035488.1
RefSeq Size 1903 bp
RefSeq ORF 666 bp
Locus ID 20382
UniProt ID Q62093
Gene Summary The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...