Cxcl12 (NM_013655) Mouse Untagged Clone

CAT#: MC209372

Cxcl12 (untagged) - Mouse chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript variant 2, (10ug)



  "NM_013655" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms PB; Pbsf; PBSF/SD; Scyb1; Scyb12; Sdf; SDF-; Sdf1; TLS; Tlsf; TP; Tpar1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209372 representing NM_013655
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGCCAAGGTCGTCGCCGTGCTGGCCCTGGTGCTGGCCGCGCTCTGCATCAGTGACGGTAAACCAG
TCAGCCTGAGCTACCGATGCCCCTGCCGGTTCTTCGAGAGCCACATCGCCAGAGCCAACGTCAAGCATCT
GAAAATCCTCAACACTCCAAACTGTGCCCTTCAGATTGTTGCACGGCTGAAGAACAACAACAGACAAGTG
TGCATTGACCCGAAATTAAAGTGGATCCAAGAGTACCTGGAGAAAGCTTTAAACAAGAGGCTCAAGATGT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013655
Insert Size 282 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013655.4, NP_038683.1
RefSeq Size 3173 bp
RefSeq ORF 282 bp
Locus ID 20315
UniProt ID P40224
Gene Summary This gene encodes a member of the alpha chemokine protein family. The encoded protein is secreted and functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4. The encoded protein plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region compared to variant 3. The resulting isoform (beta) is shorter and has a distinct C-terminus compared to isoform gamma. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...