United States
Germany
Japan
United Kingdom
China
Ccl5 (NM_013653) Mouse Untagged Clone
CAT＃: MC209366
Ccl5 (untagged) - Mouse chemokine (C-C motif) ligand 5 (Ccl5), (10ug)
CNY 1,320.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | MuRantes; RANTES; Scya5; SISd; TCP228 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209366 representing NM_013653.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGATCTCTGCAGCTGCCCTCACCATCATCCTCACTGCAGCCGCCCTCTGCACCCCCGCACCTGCC TCACCATATGGCTCGGACACCACTCCCTGCTGCTTTGCCTACCTCTCCCTCGCGCTGCCTCGTGCCCAC GTCAAGGAGTATTTCTACACCAGCAGCAAGTGCTCCAATCTTGCAGTCGTGTTTGTCACTCGAAGGAAC CGCCAAGTGTGTGCCAACCCAGAGAAGAAGTGGGTTCAAGAATACATCAACTATTTGGAGATGAGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites |
SgfI-MluI
Plasmid Map
|
| ACCN | NM_013653 |
| Insert Size | 276 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013653.3 |
| RefSeq Size | 579 bp |
| RefSeq ORF | 276 bp |
| Locus ID | 20304 |
| UniProt ID | P30882 |
| MW | 10.1 kDa |
| Gene Summary | Chemoattractant for blood monocytes, memory T-helper cells and eosinophils. Causes the release of histamine from basophils and activates eosinophils. May activate several chemokine receptors including CCR1, CCR3, CCR4 and CCR5. May also be an agonist of the G protein-coupled receptor GPR75. Together with GPR75, may play a role in neuron survival through activation of a downstream signaling pathway involving the PI3, Akt and MAP kinases. By activating GPR75 may also play a role in insulin secretion by islet cells.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227153 | Ccl5 (tGFP-tagged) - Mouse chemokine (C-C motif) ligand 5 (Ccl5), (10ug) |
CNY 2,800.00 |
|
| MR227153 | Ccl5 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 5 (Ccl5) |
CNY 1,200.00 |
|
| MR227153L3 | Lenti ORF clone of Ccl5 (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 5 (Ccl5) |
CNY 4,750.00 |
|
| MR227153L4 | Lenti ORF clone of Ccl5 (mGFP-tagged) - Mouse chemokine (C-C motif) ligand 5 (Ccl5) |
CNY 4,750.00 |
