Rnf7 (NM_011279) Mouse Untagged Clone
CAT#: MC209319
Rnf7 (untagged) - Mouse ring finger protein 7 (Rnf7), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Rbx2; SAG |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209319 representing NM_011279
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGACGTGGAGGACGGCGAGGAACCCTGCGTCCTTTCTTCGCACTCCGGGAGCGCAGGCTCCAAGT CGGGAGGCGACAAGATGTTCTCTCTCAAGAAGTGGAACGCGGTAGCCATGTGGAGCTGGGACGTTGAGTG CGATACCTGTGCCATCTGCAGGGTCCAGGTGATGGATGCCTGCCTTCGATGTCAAGCTGAAAACAAGCAA GAGGACTGTGTTGTGGTCTGGGGAGAGTGTAACCATTCCTTCCACAACTGCTGCATGTCCCTGTGGGTGA AACAGAACAATCGCTGCCCTCTGTGCCAGCAGGACTGGGTAGTCCAAAGAATCGGCAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011279 |
Insert Size | 342 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_011279.3, NP_035409.1 |
RefSeq Size | 1232 bp |
RefSeq ORF | 342 bp |
Locus ID | 19823 |
UniProt ID | Q9WTZ1 |
Gene Summary | Probable component of the SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins involved in cell cycle progression, signal transduction and transcription (By similarity). CRLs complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins, ARIH1 mediating addition of the first ubiquitin on CRLs targets (By similarity). Through the RING-type zinc finger, seems to recruit the E2 ubiquitination enzyme to the complex and brings it into close proximity to the substrate. Promotes the neddylation of CUL5 via its interaction with UBE2F. May play a role in protecting cells from apoptosis induced by redox agents (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220386 | Rnf7 (tGFP-tagged) - Mouse ring finger protein 7 (Rnf7), (10ug) |
CNY 2,850.00 |
|
MR220386 | Rnf7 (Myc-DDK-tagged) - Mouse ring finger protein 7 (Rnf7) |
CNY 1,200.00 |
|
MR220386L3 | Lenti ORF clone of Rnf7 (Myc-DDK-tagged) - Mouse ring finger protein 7 (Rnf7) |
CNY 4,750.00 |
|
MR220386L4 | Lenti ORF clone of Rnf7 (mGFP-tagged) - Mouse ring finger protein 7 (Rnf7) |
CNY 4,750.00 |