Rbp4 (NM_011255) Mouse Untagged Clone

CAT#: MC209304

Rbp4 (untagged) - Mouse retinol binding protein 4, plasma (Rbp4), transcript variant 2, (10ug)



  "NM_011255" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Rbp-4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209304 representing NM_011255
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTGGGTGTGGGCGCTCGTGCTGCTGGCGGCTCTGGGAGGCGGCAGCGCCGAGCGCGACTGCAGGG
TGAGCAGCTTCCGAGTCAAGGAGAACTTCGACAAGGCTCGTTTCTCTGGGCTCTGGTATGCCATCGCCAA
AAAGGACCCCGAGGGTCTCTTTTTGCAAGACAACATCATCGCTGAGTTTTCTGTGGACGAGAAGGGTCAT
ATGAGCGCCACAGCCAAGGGACGAGTCCGTCTTCTGAGCAACTGGGAAGTGTGTGCAGACATGGTGGGCA
CTTTCACAGACACTGAAGATCCTGCCAAGTTCAAGATGAAGTACTGGGGTGTAGCCTCCTTTCTCCAGCG
AGGAAACGATGACCACTGGATCATCGACACGGACTACGACACCTTCGCTCTGCAGTACTCCTGCCGCCTG
CAGAATCTGGATGGCACCTGTGCAGACAGCTACTCCTTTGTGTTTTCTCGTGACCCCAATGGCCTGAGCC
CAGAGACACGGAGGCTGGTGAGGCAGCGGCAGGAGGAGCTGTGCCTAGAGAGGCAGTACAGATGGATTGA
ACACAATGGTTACTGTCAAAGCAGGCCCTCCAGAAACAGTTTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011255
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011255.3, NP_035385.1
RefSeq Size 930 bp
RefSeq ORF 606 bp
Locus ID 19662
UniProt ID Q00724
Gene Summary Retinol-binding protein that mediates retinol transport in blood plasma. Delivers retinol from the liver stores to the peripheral tissues. Transfers the bound all-trans retinol to STRA6, that then facilitates retinol transport across the cell membrane.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream translational start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...