Ptgds (NM_008963) Mouse Untagged Clone
CAT#: MC209254
Ptgds (untagged) - Mouse prostaglandin D2 synthase (brain) (Ptgds), (10ug)
CNY 3,990.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 21kDa; L-PGDS; PGD2; PGDS; PGDS2; Ptgs3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209254 representing NM_008963
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGCTCTTCGCATGCTGTGGATGGGTTTGGTCCTCCTGGGTCTCTTGGGATTCCCACAGACCCCAG CCCAGGGCCATGACACAGTGCAGCCCAACTTTCAACAAGACAAGTTCCTGGGGCGCTGGTACAGCGCGGG CCTCGCCTCCAACTCAAGCTGGTTCCGGGAGAAGAAAGCTGTATTGTATATGTGCAAGACAGTGGTAGCC CCCTCCACAGAAGGCGGCCTCAATCTCACCTCTACCTTCCTCAGGAAAAACCAGTGTGAGACCAAGATCA TGGTACTGCAGCCTGCGGGGGCTCCTGGACACTACACCTACAGCAGCCCCCACTCGGGCAGCATCCACTC CGTGTCAGTGGTGGAGGCCAACTATGACGAGTACGCTCTGCTATTCAGCAGAGGCACCAAGGGCCCAGGC CAGGACTTCCGCATGGCCACCCTCTACAGCAGAACCCAGACTCTGAAGGACGAGCTGAAGGAGAAATTCA CCACCTTTAGCAAGGCCCAGGGCCTCACAGAGGAGGACATTGTTTTCCTGCCCCAACCGGATAAGTGCAT TCAAGAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008963 |
Insert Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008963.2, NP_032989.2 |
RefSeq Size | 806 bp |
RefSeq ORF | 570 bp |
Locus ID | 19215 |
UniProt ID | O09114 |
Gene Summary | Catalyzes the conversion of PGH2 to PGD2, a prostaglandin involved in smooth muscle contraction/relaxation and a potent inhibitor of platelet aggregation. Involved in a variety of CNS functions, such as sedation, NREM sleep and PGE2-induced allodynia, and may have an anti-apoptotic role in oligodendrocytes. Binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophobic molecules and as a secretory retinoid and thyroid hormone transporter. Possibly involved in development and maintenance of the blood-brain, blood-retina, blood-aqueous humor and blood-testis barrier. It is likely to play important roles in both maturation and maintenance of the central nervous system and male reproductive system.[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Transferrin is responsible for mediating the effects of iron ions on the regulation of anterior pharynx-defective-1α/β and Presenilin 1 expression via PGE2 and PGD2 at the early stage of Alzheimer's Disease
,Lu, CD;Ma, JK;Luo, ZY;Tai, QX;Wang, P;Guan, PP;,
Aging (Albany NY) 2018
,PubMed ID 30383537
[PTGDS]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224724 | Ptgds (tGFP-tagged) - Mouse prostaglandin D2 synthase (brain) (Ptgds), (10ug) |
CNY 2,090.00 |
|
MR224724 | Ptgds (Myc-DDK-tagged) - Mouse prostaglandin D2 synthase (brain) (Ptgds) |
CNY 1,900.00 |
|
MR224724L3 | Lenti ORF clone of Ptgds (Myc-DDK-tagged) - Mouse prostaglandin D2 synthase (brain) (Ptgds) |
CNY 3,800.00 |
|
MR224724L4 | Lenti ORF clone of Ptgds (mGFP-tagged) - Mouse prostaglandin D2 synthase (brain) (Ptgds) |
CNY 3,800.00 |