United States
Germany
Japan
United Kingdom
China
Psma3 (NM_011184) Mouse Untagged Clone
CAT＃: MC209244
Psma3 (untagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 3 (Psma3), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Lmpc8 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209244 representing NM_011184
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCTCCATCGGCACTGGGTATGACTTGTCAGCCTCTACGTTCTCTCCTGATGGAAGAGTTTTCCAAG TTGAATATGCCATGAAGGCTGTGGAAAACAGTAGTACAGCTATTGGGATCAGATGTAAAGATGGTGTTGT GTTTGGGGTAGAAAAACTAGTCCTTTCTAAACTTTATGAAGAAGGCTCCAATAAACGTCTTTTTAATGTT GATCGACATGTTGGAATGGCAGTTGCAGGTTTGCTGGCAGATGCTCGTTCATTAGCAGACATAGCGAGAG AAGAAGCATCCAACTTTAGGTCCAACTTCGGCTATAACATTCCTCTAAAACATCTTGCAGACAGAGTGGC CATGTATGTACACGCCTATACACTCTACAGCGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTGGGGTCT TACAGTGCGAATGATGGTGCACAGCTCTATATGATCGACCCATCAGGTGTTTCATATGGTTACTGGGGCT GTGCGATTGGCAAAGCCAGGCAGGCTGCAAAGACAGAGATAGAAAAGCTTCAGATGAAGGAAATGACTTG CCGTGATGTAGTTAAAGAAGTTGCAAAAATAATTTACATAGTACACGATGAAGTTAAGGATAAAGCTTTT GAACTGGAGCTCAGCTGGGTTGGTGAATTAACTAAAGGAAGACATGAAATTGTTCCCAAAGACATAAGAG AGGAAGCAGAGAAATATGCCAAGGAATCTTTGAAGGAAGAAGATGAATCAGATGATGACAATATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_011184 |
| Insert Size | 768 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_011184.5, NP_035314.3 |
| RefSeq Size | 2374 bp |
| RefSeq ORF | 768 bp |
| Locus ID | 19167 |
| UniProt ID | O70435 |
| Gene Summary | Component of the 20S core proteasome complex involved in the proteolytic degradation of most intracellular proteins. This complex plays numerous essential roles within the cell by associating with different regulatory particles. Associated with two 19S regulatory particles, forms the 26S proteasome and thus participates in the ATP-dependent degradation of ubiquitinated proteins. The 26S proteasome plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins that could impair cellular functions, and by removing proteins whose functions are no longer required. Associated with the PA200 or PA28, the 20S proteasome mediates ubiquitin-independent protein degradation. This type of proteolysis is required in several pathways including spermatogenesis (20S-PA200 complex) or generation of a subset of MHC class I-presented antigenic peptides (20S-PA28 complex). Binds to the C-terminus of CDKN1A and thereby mediates its degradation. Negatively regulates the membrane trafficking of the cell-surface thromboxane A2 receptor (TBXA2R) isoform 2.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203270 | Psma3 (tGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 3 (Psma3) |
CNY 2,850.00 |
|
| MR203270 | Psma3 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 3 (Psma3) |
CNY 2,400.00 |
|
| MR203270L3 | Lenti ORF clone of Psma3 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 3 (Psma3) |
CNY 4,750.00 |
|
| MR203270L4 | Lenti ORF clone of Psma3 (mGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 3 (Psma3) |
CNY 4,750.00 |
