Pou4f1 (NM_011143) Mouse Untagged Clone

CAT#: MC209204

Pou4f1 (untagged) - Mouse POU domain, class 4, transcription factor 1 (Pou4f1), (10ug)



  "NM_011143" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Brn-3; Brn-3.0; Brn3; Brn3.0; Brn3a; E130119J07Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209204 representing NM_011143
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGTCCATGAACAGCAAGCAGCCTCACTTTGCCATGCATCCCACCCTCCCTGAGCACAAGTACCCGT
CGCTGCACTCCAGCTCCGAGGCCATCCGGCGGGCCTGCCTGCCCACGCCGCCGCTGCAGAGCAACCTCTT
CGCCAGCCTGGACGAGACGCTGCTGGCGCGGGCCGAGGCGCTGGCGGCCGTGGACATCGCGGTGTCCCAG
GGCAAGAGCCACCCTTTCAAGCCGGACGCCACGTACCACACGATGAATAGCGTGCCCTGCACGTCCACGT
CCACCGTGCCGCTGGCGCACCACCACCACCACCACCACCACCACCAGGCGCTCGAGCCCGGTGACCTGCT
GGACCACATCTCGTCGCCGTCGCTCGCGCTCATGGCCGGCGCAGGGGGCGCAGGCGCGGCGGGAGGCGGC
GGCGGCGCCCACGACGGCCCCGGGGGCGGAGGCGGACCGGGGGGCGGCGGTGGCCCGGGCGGCGGCGGCC
CCGGGGGTGGCGGCGGCGGCGGCGGCCCGGGGGGCGGCGGCGGCGGCCCGGGCGGCGGGCTCTTGGGCGG
CTCGGCGCATCCGCACCCGCACATGCACGGCCTGGGCCACCTGTCGCACCCCGCGGCGGCGGCGGCCATG
AACATGCCGTCCGGGCTGCCGCATCCCGGGCTCGTGGCCGCGGCGGCGCACCACGGCGCGGCGGCGGCAG
CGGCGGCGGCGGCGGCGGGGCAGGTGGCGGCGGCGTCGGCCGCGGCGGCGGTGGTGGGCGCGGCGGGCCT
GGCGTCCATCTGCGACTCGGACACGGACCCGCGCGAGCTCGAGGCGTTCGCCGAGCGCTTCAAGCAGCGG
CGCATCAAGCTGGGCGTGACGCAGGCCGACGTGGGCTCGGCGCTGGCCAACCTCAAGATCCCGGGCGTGG
GCTCGCTCAGCCAGAGCACCATCTGCAGGTTCGAGTCGCTCACGCTCTCGCACAACAACATGATCGCGCT
CAAGCCCATCCTGCAGGCGTGGCTGGAGGAGGCCGAGGGCGCGCAGCGTGAGAAAATGAACAAGCCGGAG
CTCTTCAACGGCGGCGAGAAGAAGCGCAAGCGGACTTCCATCGCCGCGCCCGAGAAGCGCTCCCTCGAGG
CCTATTTTGCCGTACAACCCCGGCCCTCGTCTGAGAAGATCGCCGCCATCGCCGAGAAACTGGACCTCAA
AAAGAACGTGGTGCGGGTGTGGTTTTGCAACCAGAGACAGAAGCAGAAGCGGATGAAATTCTCTGCCACT
TACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011143
Insert Size 1266 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011143.4, NP_035273.3
RefSeq Size 3801 bp
RefSeq ORF 1266 bp
Locus ID 18996
UniProt ID P17208
Gene Summary Multifunctional transcription factor with different regions mediating its different effects (PubMed:10640682, PubMed:8621561, PubMed:9694219, PubMed:9722627). Acts by binding (via its C-terminal domain) to sequences related to the consensus octamer motif 5'-ATGCAAAT-3' in the regulatory regions of its target genes (PubMed:8621561, PubMed:17668438). Regulates the expression of specific genes involved in differentiation and survival within a subset of neuronal lineages. It has been shown that activation of some of these genes requires its N-terminal domain, maybe through a neuronal-specific cofactor (PubMed:12934100). Ativates BCL2 expression and protects neuronal cells from apoptosis (via the N-terminal domain) (PubMed:9722627). Induces neuronal process outgrowth and the coordinate expression of genes encoding synaptic proteins (PubMed:8972215). Exerts its major developmental effects in somatosensory neurons and in brainstem nuclei involved in motor control. Stimulates the binding affinity of the nuclear estrogene receptor ESR1 to DNA estrogen response element (ERE), and hence modulates ESR1-induced transcriptional activity (PubMed:9448000). May positively regulate POU4F2 and POU4F3 (PubMed:8876243). Regulates dorsal root ganglion sensory neuron specification and axonal projection into the spinal cord (PubMed:22326227). Plays a role in TNFSF11-mediated terminal osteoclast differentiation (PubMed:17668438). Negatively regulates its own expression interacting directly with a highly conserved autoregulatory domain surrounding the transcription initiation site (PubMed:12441296).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...