United States
Germany
Japan
United Kingdom
China
Pkia (NM_008862) Mouse Untagged Clone
CAT＃: MC209178
Pkia (untagged) - Mouse protein kinase inhibitor, alpha (Pkia), (10ug)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI415001; PKIalpha |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_008862, the custom clone sequence may differ by one or more nucleotides
ATGACTGATGTGGAAACTACGTATGCAGATTTCATTGCTTCAGGAAGAACAGGTAGAAGAAATGCAATAC ATGATATCCTGGTTTCCTCTGCAAGTGGCAACAGCAATGAATTAGCCTTAAAACTAGCAGGCCTTGATAT CAACAAGACAGAAGGTGAAGATGATGGACAGAGAAGCTCCACCGAACAAAGTGGAGAAGCCCAGGGAGAA GCAGCCAAGTCTGAAAGCTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008862 |
| Insert Size | 231 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC048244, AAH48244 |
| RefSeq Size | 3640 bp |
| RefSeq ORF | 231 bp |
| Locus ID | 18767 |
| UniProt ID | P63248 |
| Gene Summary | Extremely potent competitive inhibitor of cAMP-dependent protein kinase activity, this protein interacts with the catalytic subunit of the enzyme after the cAMP-induced dissociation of its regulatory chains.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200113 | Pkia (tGFP-tagged) - Mouse protein kinase inhibitor, alpha (Pkia) |
CNY 2,850.00 |
|
| MR200113 | Pkia (Myc-DDK-tagged) - Mouse protein kinase inhibitor, alpha (Pkia) |
CNY 1,200.00 |
|
| MR200113L3 | Lenti ORF clone of Pkia (Myc-DDK-tagged) - Mouse protein kinase inhibitor, alpha (Pkia) |
CNY 4,750.00 |
|
| MR200113L4 | Lenti ORF clone of Pkia (mGFP-tagged) - Mouse protein kinase inhibitor, alpha (Pkia) |
CNY 4,750.00 |
