Pitx3 (NM_008852) Mouse Untagged Clone
CAT#: MC209172
Pitx3 (untagged) - Mouse paired-like homeodomain transcription factor 3 (Pitx3), (10ug)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | ak; Ptx3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209172 representing NM_008852
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTTTGGGCTGCTTGGTGAGGCAGAGGCGCGAAGCCCTGCGCTGTCGTTATCGGACGCAGGCACTC CACACCCTCCGCTTCCAGAACATGGCTGCAAGGGGCAGGAGCACAGTGACTCGGAGAAGGCCTCGGCCTC ACTGCCGGGGGGCTCCCCCGAGGACGGCTCTCTGAAGAAGAAGCAGCGGCGGCAGCGCACGCACTTCACC AGCCAGCAGCTGCAGGAGCTGGAGGCCACCTTCCAGAGGAATCGCTACCCTGACATGAGCACCCGCGAAG AGATCGCGGTGTGGACCAACCTCACTGAGGCCCGCGTGCGGGTGTGGTTCAAGAACCGGCGCGCAAAGTG GCGGAAGCGGGAGCGCAGCCAGCAGGCGGAGCTGTGCAAAGGTGGCTTCGCAGCCCCGCTCGGGGGCCTG GTGCCACCCTACGAGGAGGTGTACCCGGGCTACTCGTACGGCAACTGGCCGCCCAAGGCTCTCGCCCCGC CGCTCGCCGCCAAGACCTTCCCGTTCGCCTTCAACTCGGTCAACGTGGGGCCTCTGGCTTCACAGCCTGT ATTCTCACCGCCCAGCTCCATCGCCGCTTCTATGGTGCCCTCGGCCGCCGCTGCCCCGGGCACCGTACCA GGTCCCGGAGCCTTGCAGGGCCTGGGCGGGGCACCCCCCGGGCTGGCTCCAGCCGCCGTGTCCTCCGGGG CAGTGTCCTGCCCTTACGCCTCGGCCGCCGCAGCCGCCGCTGCAGCCGCCTCCTCCCCCTATGTATACCG GGACCCGTGTAACTCGAGCCTGGCTAGCCTGCGGCTCAAAGCCAAGCAGCACGCCTCTTTCAGCTATCCC GCCGTGCCCGGGCCGCCGCCGGCCGCTAACCTTAGCCCCTGCCAGTACGCCGTGGAACGGCCGGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008852 |
Insert Size | 909 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC120844, AAI20845 |
RefSeq Size | 1227 bp |
RefSeq ORF | 909 bp |
Locus ID | 18742 |
UniProt ID | O35160 |
Gene Summary | Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. In addition to its importance during development, it also has roles in the long-term survival and maintenance of the mdDA neurons. Activates NR4A2/NURR1-mediated transcription of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons. Acts by decreasing the interaction of NR4A2/NURR1 with the corepressor NCOR2/SMRT which acts through histone deacetylases (HDACs) to keep promoters of NR4A2/NURR1 target genes in a repressed deacetylated state. Essential for the normal lens development and differentiation. Plays a critical role in the maintenance of mitotic activity of lens epithelial cells, fiber cell differentiation and in the control of the temporal and spatial activation of fiber cell-specific crystallins. Positively regulates FOXE3 expression and negatively regulates PROX1 in the anterior lens epithelium, preventing activation of CDKN1B/P27Kip1 and CDKN1C/P57Kip2 and thus maintains lens epithelial cells in cell cycle.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222093 | Pitx3 (tGFP-tagged) - Mouse paired-like homeodomain transcription factor 3 (Pitx3), (10ug) |
CNY 5,200.00 |
|
MR222093 | Pitx3 (Myc-DDK-tagged) - Mouse paired-like homeodomain transcription factor 3 (Pitx3) |
CNY 3,600.00 |
|
MR222093L3 | Lenti ORF clone of Pitx3 (Myc-DDK-tagged) - Mouse paired-like homeodomain transcription factor 3 (Pitx3) |
CNY 5,890.00 |
|
MR222093L4 | Lenti ORF clone of Pitx3 (mGFP-tagged) - Mouse paired-like homeodomain transcription factor 3 (Pitx3) |
CNY 5,890.00 |