United States
Germany
Japan
United Kingdom
China
Pitx2 (NM_001042502) Mouse Untagged Clone
CAT＃: MC209170
Pitx2 (untagged) - Mouse paired-like homeodomain transcription factor 2 (Pitx2), transcript variant 3, (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 9430085M16Rik; Brx1; Brx1b; Munc30; Otlx2; Ptx2; Rieg |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001042502, the custom clone sequence may differ by one or more nucleotides
ATGAACTGCATGAAAGGCCCGCTGCCCTTGGAGCACCGAGCAGCCGGGACTAAGCTGTCGGCCGCCTCCT CACCCTTCTGTCACCATCCCCAGGCGTTAGCCATGGCTTCGGTCCTAGCTCCTGGCCAGCCCCGCTCCTT GGACTCCTCCAAACATAGACTGGAGGTGCATACAATCTCCGATACTTCCAGCCCTGAAGTCGCAGAGAAA GATAAGGGCCAGCAAGGAAAGAATGAGGATGTGGGCGCCGAGGACCCGTCCAAGAAGAAGCGGCAACGCC GGCAGAGGACTCATTTCACTAGCCAGCAGCTGCAGGAGCTGGAAGCCACTTTCCAGAGAAACCGCTACCC AGACATGTCCACTCGCGAAGAAATCGCCGTGTGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTC AAGAATCGCCGGGCCAAATGGAGAAAGCGGGAACGCAACCAGCAGGCCGAGCTGTGCAAGAATGGCTTTG GGCCGCAGTTCAACGGGCTCATGCAGCCCTACGATGACATGTACCCCGGCTATTCGTACAACAATTGGGC TGCCAAGGGCCTCACGTCAGCGTCTCTGTCCACCAAGAGCTTCCCCTTCTTCAACTCCATGAACGTCAAT CCCCTGTCCTCTCAGAGTATGTTTTCCCCGCCCAACTCCATCTCATCTATGAGTATGTCGTCCAGCATGG TGCCCTCCGCGGTGACCGGCGTCCCGGGCTCCAGCCTCAATAGCCTGAATAACTTGAACAACCTGAGCAG CCCGTCGCTGAATTCCGCGGTGCCCACGCCCGCCTGTCCTTACGCGCCGCCGACTCCTCCGTACGTTTAT AGGGACACATGTAACTCGAGCCTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACG CCAGCGTGCAGAACCCGGCCTCCAACCTGAGTGCTTGCCAGTATGCAGTCGACCGGCCGGTGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001042502 |
| Insert Size | 975 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC075660, AAH75660 |
| RefSeq Size | 1995 bp |
| RefSeq ORF | 975 bp |
| Locus ID | 18741 |
| UniProt ID | P97474 |
| Gene Summary | Controls cell proliferation in a tissue-specific manner and is involved in morphogenesis. During embryonic development, exerts a role in the expansion of muscle progenitors. May play a role in the proper localization of asymmetric organs such as the heart and stomach. Isoform Ptx2c is involved in left-right asymmetry the developing embryo.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) contains an alternate 5' terminal exon, lacks a portion of the 5' coding region and initiates translation at an alternate start codon compared to variant 1. The encoded protein (isoform c, also known as PITX2Calpha (PMID 18373856)) has a distinct N-terminus and is longer than isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227605 | Pitx2 (tGFP-tagged) - Mouse paired-like homeodomain transcription factor 2 (Pitx2) transcript variant 3, (10ug) |
CNY 3,520.00 |
|
| MR227605 | Pitx2 (Myc-DDK-tagged) - Mouse paired-like homeodomain transcription factor 2 (Pitx2), transcript variant 3 |
CNY 3,230.00 |
|
| MR227605L3 | Lenti ORF clone of Pitx2 (Myc-DDK-tagged) - Mouse paired-like homeodomain transcription factor 2 (Pitx2), transcript variant 3 |
CNY 5,130.00 |
|
| MR227605L4 | Lenti ORF clone of Pitx2 (mGFP-tagged) - Mouse paired-like homeodomain transcription factor 2 (Pitx2), transcript variant 3 |
CNY 5,130.00 |
