United States
Germany
Japan
United Kingdom
China
Pim2 (NM_138606) Mouse Untagged Clone
CAT＃: MC209167
Pim2 (untagged) - Mouse proviral integration site 2 (Pim2), (10ug)
CNY 5,488.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | DXCch3; Pim-2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209167 representing NM_138606
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_138606 |
| Insert Size | 1113 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138606.2, NP_613072.1 |
| RefSeq Size | 2054 bp |
| RefSeq ORF | 1113 bp |
| Locus ID | 18715 |
| UniProt ID | Q62070 |
| Gene Summary | Proto-oncogene with serine/threonine kinase activity involved in cell survival and cell proliferation. Exerts its oncogenic activity through: the regulation of MYC transcriptional activity, the regulation of cell cycle progression, the regulation of cap-dependent protein translation and through survival signaling by phosphorylation of a pro-apoptotic protein, BAD. Phosphorylation of MYC leads to an increase of MYC protein stability and thereby an increase of transcriptional activity. The stabilization of MYC exerted by PIM2 might explain partly the strong synergism between these 2 oncogenes in tumorigenesis. Regulates cap-dependent protein translation in a mammalian target of rapamycin complex 1 (mTORC1)-independent manner and in parallel to the PI3K-Akt pathway. Mediates survival signaling through phosphorylation of BAD, which induces release of the anti-apoptotic protein Bcl-X(L)/BCL2L1. Promotes cell survival in response to a variety of proliferative signals via positive regulation of the I-kappa-B kinase/NF-kappa-B cascade; this process requires phosphorylation of MAP3K8/COT. Promotes growth factor-independent proliferation by phosphorylation of cell cycle factors such as CDKN1A and CDKN1B. Involved in the positive regulation of chondrocyte survival and autophagy in the epiphyseal growth plate.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222342 | Pim2 (tGFP-tagged) - Mouse proviral integration site 2 (Pim2), (10ug) |
CNY 7,088.00 |
|
| MR222342 | Pim2 (Myc-DDK-tagged) - Mouse proviral integration site 2 (Pim2) |
CNY 5,488.00 |
|
| MR222342L1 | Lenti ORF clone of Pim2 (Myc-DDK-tagged) - Mouse proviral integration site 2 (Pim2) |
CNY 5,890.00 |
|
| MR222342L2 | Lenti ORF clone of Pim2 (mGFP-tagged) - Mouse proviral integration site 2 (Pim2) |
CNY 7,888.00 |
|
| MR222342L3 | Lenti ORF clone of Pim2 (Myc-DDK-tagged) - Mouse proviral integration site 2 (Pim2) |
CNY 5,890.00 |
|
| MR222342L4 | Lenti ORF clone of Pim2 (mGFP-tagged) - Mouse proviral integration site 2 (Pim2) |
CNY 5,890.00 |
