Mocs2 (NM_013826) Mouse Untagged Clone

CAT#: MC208968

Mocs2 (untagged) - Mouse molybdenum cofactor synthesis 2 (Mocs2), transcript variant 1, (10ug)



  "NM_013826" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI415403
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208968 representing NM_013826
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTCCTAGGTGCCAGATTGACGTGTTGTATTTTGCAAAAAGTGCTGAAATAGCCGGAGTTCGCTCGG
AGACCATTTCTGTGCCACAGGAAATCAAAGCGTCAGAGCTGTGGAAGGAGCTAGAGAGTCTCCATCCTGG
GTTGGCTGATGTTAGAAACCAGGTGATATTTGCTGTTCGTCAAGAGTATGTCGAGCTTGGAGATCAGCAA
CTCCTGCTTCAGCCCGGAGATGAGGTTGCCATCATCCCGCCAATCAGTGGAGGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013826
Insert Size 267 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013826.3, NP_038854.2
RefSeq Size 1889 bp
RefSeq ORF 267 bp
Locus ID 17434
UniProt ID Q9Z223
Gene Summary Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. Based on experiments with the human molybdopterin synthase ortholog, they are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the small subunit (Mocs2A). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...