United States
Germany
Japan
United Kingdom
China
Max (NM_001146176) Mouse Untagged Clone
CAT＃: MC208941
Max (untagged) - Mouse Max protein (Max), transcript variant 2, (10ug)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AA960152; AI875693; bHLHd4; bHLHd5; bHLHd6; bHLHd7; bHLHd8 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208941 representing NM_001146176
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGATAACGATGACATCGAGGTGGAGAGCGACGCTGACAAGCGGGCTCACCATAATGCACTGGAAC GAAAACGTAGGGACCACATCAAAGACAGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGA GAAGGCATCCCGGGCCCAAATCCTAGACAAAGCAACAGAGTATATCCAGTATATGCGAAGGAAAAACCAT ACGCACCAGCAAGACATTGATGACCTCAAGCGGCAGAATGCTCTTCTGGAGCAACAAGTCCGTGCACTGG AGAAGGCAAGATCAAGTGCCCAACTGCAGACCAACTACCCCTCCTCAGACAACAGCCTCTACACCAACGC CAAGGGCGGCACCATCTCTGCCTTCGATGGGGGTTCAGACTCCAGCTCAGAATCCGAGCCTGAAGAGCCC CAGAGCAGGAAGAAACTCCGGATGGAGGCCAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001146176 |
| Insert Size | 456 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001146176.1, NP_001139648.1 |
| RefSeq Size | 1978 bp |
| RefSeq ORF | 456 bp |
| Locus ID | 17187 |
| UniProt ID | P28574 |
| Gene Summary | Transcription regulator. Forms a sequence-specific DNA-binding protein complex with MYC or MAD which recognizes the core sequence 5'-CAC[GA]TG-3'. The MYC:MAX complex is a transcriptional activator, whereas the MAD:MAX complex is a repressor. CpG methylation of the recognition site greatly inhibits DNA binding, suggesting that DNA methylation may regulate the MYC:MAX complex in vivo. May repress transcription via the recruitment of a chromatin remodeling complex containing H3 'Lys-9' histone methyltransferase activity. Represses MYC transcriptional activity from E-box elements (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the 5' coding region compared to variant 1 but maintains the reading frame. The encoded protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG224686 | Max (tGFP-tagged) - Mouse Max protein (Max) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
| MR224686 | Max (Myc-DDK-tagged) - Mouse Max protein (Max), transcript variant 2 |
CNY 1,900.00 |
|
| MR224686L3 | Lenti ORF clone of Max (Myc-DDK-tagged) - Mouse Max protein (Max), transcript variant 2 |
CNY 3,800.00 |
|
| MR224686L4 | Lenti ORF clone of Max (mGFP-tagged) - Mouse Max protein (Max), transcript variant 2 |
CNY 3,800.00 |
