Fxyd3 (NM_008557) Mouse Untagged Clone
CAT#: MC208939
Fxyd3 (untagged) - Mouse FXYD domain-containing ion transport regulator 3 (Fxyd3), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Mat; Mat8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208939 representing NM_008557
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAAGAGGTTGTTCTGAGCCTGTTGGTCCTTCTAGCAGGCCTGCCTACTTTGGATGCCAATGACCCTG AAAATAAAAATGATCCTTTCTACTATGATTGGTACAGCCTCCGAGTCGGCGGGCTCATTTGTGCAGGGAT TCTCTGTGCCCTGGGCATTATAGTCCTTATGAGTGGCAAATGCAAATGCAAGTTCAGACAGAAACCCAGT CACCGCCCAGGAGAAGGGCCACCTCTCATCACACCAGGCTCAGCTCACAACTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008557 |
Insert Size | 267 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008557.2, NP_032583.1 |
RefSeq Size | 524 bp |
RefSeq ORF | 267 bp |
Locus ID | 17178 |
UniProt ID | Q61835 |
Gene Summary | This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The encoded protein is a transmembrane protein that functions as a specific regulator of Na,K-ATPase. [provided by RefSeq, Aug 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200206 | Fxyd3 (tGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 3 (Fxyd3) |
CNY 2,090.00 |
|
MR200206 | Fxyd3 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 3 (Fxyd3) |
CNY 1,200.00 |
|
MR200206L3 | Lenti ORF clone of Fxyd3 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 3 (Fxyd3) |
CNY 3,800.00 |
|
MR200206L4 | Lenti ORF clone of Fxyd3 (mGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 3 (Fxyd3) |
CNY 3,800.00 |