United States
Germany
Japan
United Kingdom
China
Lamp2 (NM_001017959) Mouse Untagged Clone
CAT＃: MC208863
Lamp2 (untagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1, (10ug)
CNY 5,488.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD107b; Lamp-2; Lamp-2a; Lamp-2b; Lamp-2c; Lamp II; LGP-B; Mac3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208863 representing NM_001017959
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGCCTCTCTCCGGTTAAAGGCGCAAAGCTCATCCTGATCTTTCTGTTCCTAGGAGCCGTTCAGTCCA ATGCATTGATAGTTAATTTGACAGATTCAAAGGGTACTTGCCTTTATGCAGAATGGGAGATGAATTTCAC AATAACATATGAAACTACAAACCAAACCAATAAAACTATAACCATTGCAGTACCTGACAAGGCGACACAC GATGGAAGCAGTTGTGGGGATGACCGGAATAGTGCCAAAATAATGATACAATTTGGATTCGCTGTCTCTT GGGCTGTGAATTTTACCAAGGAAGCATCTCATTATTCAATTCATGACATCGTGCTTTCCTACAACACTAG TGATAGCACAGTATTTCCTGGTGCTGTAGCTAAAGGAGTTCATACTGTTAAAAATCCTGAGAATTTCAAA GTTCCATTGGATGTCATCTTTAAGTGCAATAGTGTTTTAACTTACAACCTGACTCCTGTCGTTCAGAAAT ATTGGGGTATTCACCTGCAAGCTTTTGTCCAAAATGGTACAGTGAGTAAAAATGAACAAGTGTGTGAAGA AGACCAAACTCCCACCACTGTGGCACCCATCATTCACACCACTGCCCCGTCGACTACAACTACACTCACT CCAACTTCAACACCCACTCCAACTCCAACTCCAACTCCAACCGTTGGAAACTACAGCATTAGAAATGGCA ATACTACCTGTCTGCTGGCTACCATGGGGCTGCAGCTGAACATCACTGAGGAGAAGGTGCCTTTCATTTT TAACATCAACCCTGCCACAACCAACTTCACCGGCAGCTGTCAACCTCAAAGTGCTCAACTTAGGCTGAAC AACAGCCAAATTAAGTATCTTGACTTTATCTTTGCTGTGAAAAATGAAAAACGGTTCTATCTGAAGGAAG TGAATGTCTACATGTATTTGGCTAATGGCTCAGCTTTCAACATTTCCAACAAGAACCTTAGCTTCTGGGA TGCCCCTCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGGTGCTTTCTGTGTCTAGAGCGTTTCAGATC AACACCTTTAACCTAAAGGTGCAACCTTTTAATGTGACAAAAGGACAGTATTCTACAGCTCAAGACTGCA GTGCAGATGAAGACAACTTCCTTGTGCCCATAGCGGTGGGAGCAGCTCTGGGAGGAGTACTTATTCTAGT GTTGCTGGCTTATTTTATTGGTCTCAAGCGCCATCATACTGGATATGAGCAATTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001017959 |
| Insert Size | 1248 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001017959.1, NP_001017959.1 |
| RefSeq Size | 1768 bp |
| RefSeq ORF | 1248 bp |
| Locus ID | 16784 |
| UniProt ID | P17047 |
| Gene Summary | Plays an important role in chaperone-mediated autophagy, a process that mediates lysosomal degradation of proteins in response to various stresses and as part of the normal turnover of proteins with a long biological half-live (PubMed:10972293). Functions by binding target proteins, such as GAPDH and MLLT11, and targeting them for lysosomal degradation (By similarity). Required for the fusion of autophagosomes with lysosomes during autophagy (PubMed:27628032). Cells that lack LAMP2 express normal levels of VAMP8, but fail to accumulate STX17 on autophagosomes, which is the most likely explanation for the lack of fusion between autophagosomes and lysosomes (PubMed:27628032). Required for normal degradation of the contents of autophagosomes (PubMed:10972293, PubMed:12221139). Plays a role in lysosomal protein degradation in response to starvation (PubMed:27628032). Required for efficient MHCII-mediated presentation of exogenous antigens via its function in lysosomal protein degradation; antigenic peptides generated by proteases in the endosomal/lysosomal compartment are captured by nascent MHCII subunits. Is not required for efficient MHCII-mediated presentation of endogenous antigens (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) utilizes an alternate 3'-terminal exon, compared to variant 2. Isoform 1 has a unique C-terminus compared to isoform 2. COMPLETENESS: complete on the 3' end. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222878 | Lamp2 (tGFP-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2) transcript variant 1, (10ug) |
CNY 7,088.00 |
|
| MR222878 | Lamp2 (Myc-DDK-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 |
CNY 5,488.00 |
|
| MR222878L1 | Lenti ORF clone of Lamp2 (Myc-DDK-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 |
CNY 6,080.00 |
|
| MR222878L2 | Lenti ORF clone of Lamp2 (mGFP-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 |
CNY 7,888.00 |
|
| MR222878L3 | Lenti ORF clone of Lamp2 (Myc-DDK-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 |
CNY 6,080.00 |
|
| MR222878L4 | Lenti ORF clone of Lamp2 (mGFP-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 |
CNY 7,888.00 |
