Jun (NM_010591) Mouse Untagged Clone
CAT#: MC208799
Jun (untagged) - Mouse Jun oncogene (Jun), (10ug)
CNY 3,656.00
CNY 3,990.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AP-1; c-jun; Junc |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_010591, the custom clone sequence may differ by one or more nucleotides
ATGACTGCAAAGATGGAAACGACCTTCTACGACGATGCCCTCAACGCCTCGTTCCTCCAGTCCGAGAGCG GTGCCTACGGCTACAGTAACCCTAAGATCCTAAAACAGAGCATGACCTTGAACCTGGCCGACCCGGTGGG CAGTCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTTCTCACGTCGCCCGACGTCGGGCTGCTCAAG CTGGCGTCGCCGGAGCTGGAGCGCCTGATCATCCAGTCCAGCAATGGGCACATCACCACTACACCGACCC CCACCCAGTTCTTGTGCCCCAAGAACGTGACCGACGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGC CCTGGCTGAACTGCATAGCCAGAACACGCTTCCCAG:TGTCACCTCCGCGGCACAGCCGGTCAGCGGGGC GGGCATGGTGGCTCCCGCGGTGGCCTCAGTAGCAGGCGCTGGCGGCGGTGGTGGCTACAGCGCCAGCCTG CACAGTGAGCCTCCGGTCTACGCCAACCTCAGCAACTTCAACCCGGGTGCGCTGAGCAGCGGCGGTGGGG CGCCCTCCTATGGCGCGGCCGGGCTGGCCTTTCCCTCGCAGCCGCAGCAGCAGCAGCAGCCGCCTCAGCC GCCGCACCACTTGCCCCAACAGATCCCGGTGCAGCACCCGCGGCTGCAAGCCCTGAAGGAAGAGCCGCAG ACCGTGCCGGAGATGCCGGGAGAGACGCCGCCCCTGTCCCCTATCGACATGGAGTCTCAGGAGCGGATCA AGGCAGAGAGGAAGCGCATGAGGAACCGCATTGCCGCCTCCAAGTGCCGGAAAAGGAAGCTGGAGCGGAT CGCTCGGCTAGAGGAAAAAGTGAAAACCTTGAAAGCGCAAAACTCCGAGCTGGCATCCACGGCCAACATG CTCAGGGAACAGGTGGCACAGCTTAAGCAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGC TAACGCAGCAGTTGCAAACGTTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010591 |
Insert Size | 1005 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC021888, AAH21888 |
RefSeq Size | 1983 bp |
RefSeq ORF | 1005 bp |
Locus ID | 16476 |
UniProt ID | P05627 |
Gene Summary | Transcription factor that recognizes and binds to the enhancer heptamer motif 5'-TGA[CG]TCA-3' (PubMed:14707112). Promotes activity of NR5A1 when phosphorylated by HIPK3 leading to increased steroidogenic gene expression upon cAMP signaling pathway stimulation (PubMed:17210646). Involved in activated KRAS-mediated transcriptional activation of USP28 (By similarity). Binds to the USP28 promoter (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Role of microRNA-21 in regulating 3T3-L1 adipocyte differentiation and adiponectin expression.
,null,
Molecular biology reports
,PubMed ID 23793828
[Jun]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227043 | Jun (tGFP-tagged) - Mouse Jun oncogene (Jun), (10ug) |
CNY 5,256.00 |
|
MR227043 | Jun (Myc-DDK-tagged) - Mouse Jun oncogene (Jun) |
CNY 3,656.00 |
|
MR227043L1 | Lenti ORF clone of Jun (Myc-DDK-tagged) - Mouse Jun oncogene (Jun) |
CNY 5,230.00 |
|
MR227043L2 | Lenti ORF clone of Jun (mGFP-tagged) - Mouse Jun oncogene (Jun) |
CNY 6,056.00 |
|
MR227043L3 | Lenti ORF clone of Jun (Myc-DDK-tagged) - Mouse Jun oncogene (Jun) |
CNY 6,056.00 |
|
MR227043L4 | Lenti ORF clone of Jun (mGFP-tagged) - Mouse Jun oncogene (Jun) |
CNY 6,056.00 |