United States
Germany
Japan
United Kingdom
China
Il10 (NM_010548) Mouse Untagged Clone
CAT＃: MC208764
Il10 (untagged) - Mouse interleukin 10 (Il10), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | CSIF; If2a; IL-; Il-10 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208764 representing NM_010548
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTGGCTCAGCACTGCTATGCTGCCTGCTCTTACTGACTGGCATGAGGATCAGCAGGGGCCAGTACA GCCGGGAAGACAATAACTGCACCCACTTCCCAGTCGGCCAGAGCCACATGCTCCTAGAGCTGCGGACTGC CTTCAGCCAGGTGAAGACTTTCTTTCAAACAAAGGACCAGCTGGACAACATACTGCTAACCGACTCCTTA ATGCAGGACTTTAAGGGTTACTTGGGTTGCCAAGCCTTATCGGAAATGATCCAGTTTTACCTGGTAGAAG TGATGCCCCAGGCAGAGAAGCATGGCCCAGAAATCAAGGAGCATTTGAATTCCCTGGGTGAGAAGCTGAA GACCCTCAGGATGCGGCTGAGGCGCTGTCATCGATTTCTCCCCTGTGAAAATAAGAGCAAGGCAGTGGAG CAGGTGAAGAGTGATTTTAATAAGCTCCAAGACCAAGGTGTCTACAAGGCCATGAATGAATTTGACATCT TCATCAACTGCATAGAAGCATACATGATGATCAAAATGAAAAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_010548 |
| Insert Size | 537 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC120612, AAI20613 |
| RefSeq Size | 1306 bp |
| RefSeq ORF | 537 bp |
| Locus ID | 16153 |
| UniProt ID | P18893 |
| Gene Summary | This gene encodes an anti-inflammatory cytokine that is a member of the class-2 cytokine family. The encoded protein is secreted by cells of both the innate and adaptive immune systems and is crucial for limiting the immune response to a broad range of pathogens. It also has been shown to suppress autoimmune responses. This protein mediates it's immunosuppressive signal through a specific interleukin 10 receptor complex. Aberrant functioning of this gene is associated with numerous immune disorders including graft-versus-host disease, and increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, Sep 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227034 | Il10 (tGFP-tagged) - Mouse interleukin 10 (Il10), (10ug) |
CNY 5,200.00 |
|
| MR227034 | Il10 (Myc-DDK-tagged) - Mouse interleukin 10 (Il10) |
CNY 3,600.00 |
|
| MR227034L3 | Lenti ORF clone of Il10 (Myc-DDK-tagged) - Mouse interleukin 10 (Il10) |
CNY 5,890.00 |
|
| MR227034L4 | Lenti ORF clone of Il10 (mGFP-tagged) - Mouse interleukin 10 (Il10) |
CNY 6,000.00 |
