Ifnar2 (NM_001110498) Mouse Untagged Clone

CAT#: MC208750

Ifnar2 (untagged) - Mouse interferon (alpha and beta) receptor 2 (Ifnar2), transcript variant 2, (10ug)



  "NM_001110498" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI747302; Ifnar-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208750 representing NM_001110498
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGTTCACGGTGCACCGTCTCTGCCGTCGGTCTCCTCAGCTTGTGTCTTGTGGTGTCTGCGAGCCTAG
AGACTATCACACCGTCTGCTTTTGATGGGTATCCAGATGAACCTTGCACTATAAACATAACAATACGAAA
TTCCCGGCTAATTTTATCCTGGGAATTAGAGAACAAGTCTGGCCCACCCGCTAACTACACCCTCTGGTAC
ACAGTCATGAGCAAAGACGAAAATCTGACGAAGGTTAAGAACTGTTCAGATACCACGAAGTCATCATGTG
ACGTGACAGATAAGTGGTTGGAGGGCATGGAGAGCTACGTCGTCGCCATCGTCATAGTGCACAGAGGGGA
CTTGACCGTGTGCCGCTGCTCAGACTACATCGTGCCTGCAAACGCTCCTCTTGAGCCGCCAGAATTTGAG
ATCGTTGGCTTTACAGACCACATAAACGTGACGATGGAATTTCCACCTGTCACTTCCAAAATAATCCAGG
AAAAGATGAAGACTACACCCTTTGTCATCAAAGAACAGATAGGGGACAGCGTTAGGAAGAAGCACGAGCC
CAAAGTGAATAATGTCACTGGGAACTTCACATTTGTCCTTAGAGACTTACTTCCAAAGACAAACTACTGT
GTATCTCTTTATTTTGATGATGACCCCGCAATAAAATCTCCCTTAAAATGCATCGTCCTTCAGCCTGGCC
AGGAATCAGGTATGGCTAGGTTTTTAAAATTTGCACTATTGTTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001110498
Insert Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001110498.1, NP_001103968.1
RefSeq Size 1169 bp
RefSeq ORF 747 bp
Locus ID 15976
UniProt ID O35664
Gene Summary Associates with IFNAR1 to form the type I interferon receptor. Receptor for interferons alpha and beta. Involved in IFN-mediated STAT1, STAT2 and STAT3 activation. Isoform 1 and isoform 2 are directly involved in signal transduction due to their association with the TYR kinase, JAK1. Isoform 2 and isoform 3 may be potent inhibitors of type I IFN receptor activity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the coding region, compared to variant 1, that results in a frameshift. It encodes isoform b, which has a shorter and distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...